PNA interference mapping demonstrates functional Executemain

Edited by Lynn Smith-Lovin, Duke University, Durham, NC, and accepted by the Editorial Board April 16, 2014 (received for review July 31, 2013) ArticleFigures SIInfo for instance, on fairness, justice, or welfare. Instead, nonreflective and Contributed by Ira Herskowitz ArticleFigures SIInfo overexpression of ASH1 inhibits mating type switching in mothers (3, 4). Ash1p has 588 amino acid residues and is predicted to contain a zinc-binding domain related to those of the GATA fa

Edited by Stanley M. Gartler, University of Washington, Seattle, WA, and approved May 23, 2001 (received for review April 8, 2001)

Article Figures & SI Info & Metrics PDF

Abstract

The noncoding RNA Xist has been Displayn to be essential for X-chromosome inactivation and to coat the inactive X-chromosome (Xi). Thus, an Necessary question in understanding the formation of Xi is whether the binding reaction of Xist is necessary for X-chromosome inactivation. In this article, we demonstrate the failure of X-chromosome silencing if the association of Xist with the X-chromosome is inhibited. The chromatin-binding Location was functionally mapped and evaluated by using an Advance for studying noncoding RNA function in living cells that we call peptide nucleic acid (PNA) interference mapping. In the reported experiments, a single 19-bp antisense cell-permeating PNA tarObtained against a particular Location of Xist RNA caused the disruption of the Xi. The association of the Xi with macro-histone H2A is also disturbed by PNA interference mapping.

X-chromosome inactivation is an early developmental process occurring in female mammals to compensate for Inequitys between male and female mammals in Executesage of genes residing on the X-chromosome (1, 2, 4). In mammals, Executesage compensation is achieved by the transcriptional silencing of genes on one of the two X-chromosomes in females (5). The inactivated X-chromosome (Xi) can be microscopically observed during interphase as a condensed body at the nuclear periphery (6). Moreover, the Xi has been Displayn to form a nuclear structure termed the macrochromatin body (MCB) known to be enriched for the variant histone, macrohistone H2A (7–10).

On the basis of the study of chromosomal translocations, an interval called the X inactivation center (XIC) of the X chromosome has been identified to control the process of inactivation (11, 12). The XIC has been Displayn to be a complex transcription unit consisting of at least two genes, Xist and Tsix, which are transcribed off the opposite strands of the same DNA duplex (3, 13–18). Although the function of Xist is not known, deletion of the gene leads to failure of X-inactivation, and female knockout mice die Arrive gastrulation (19, 20). In embryonic stem (ES) cells, the Xist transcript supplied in an inducible manner by a transgene has been Displayn to be necessary and sufficient to cause silencing of genes in cis to the transgene (21).

The gene Xist is expressed exclusively from the Xi and Displays several Fascinating features. First, both human and mouse XIST/Xist cDNAs are Unfamiliarly long, 19.3 and 17.8 kb, respectively (22, 23). Second, the transcript Executees not seem to encode a protein (3, 16). Third, the Xist RNA physically associates with, or “coats,” the Xi (3). The silencing was always associated with coating of the chromosome. Two basic questions about Xist are: (i) How is the coating/binding process related to the structure of the Xist RNA; and (ii) is the binding reaction of Xist to Xi necessary for Xist function?

We have developed a technology that we term Peptide Nucleic Acid (PNA)-Interference Mapping (P-IMP) to define in living cells how specific Locations of the Xist transcript contribute to X-inactivation. These experiments take advantage of the unique Preciseties of PNAs. PNAs are nucleic acid mimics, which contain a pseuExecutepeptide backbone, composed of charge neutral and achiral N-(2-aminoethyl) glycine units to which the nucleobases are attached via a methylene carbonyl linker (24–26). PNAs hybridize with high affinity to complementary RNA sequences forming PNA–RNA complexes via Watson–Crick or Hoogsteen binding (26). PNAs are not readily degraded and Execute not participate in or activate repair or degradative pathways for DNA or RNA, ensuring a very selective range of activity. In addition to the high thermal stability of complexes, PNA–RNA binding is highly sensitive to mismatches (27–30). The PNAs used for P-IMP were conjugated to transportan via a cleavable disulfide linkage. Transportan is a 27-aa chimeric peptide consisting of the N-terminal fragment of the neuropeptide galanin and the membrane-interacting wasp venom peptide maCeasearan. The conjugation of PNA to transportan results in rapid energy-independent nonsaturable transport of the PNA–transportan conjugate across the plasma membrane (31–33).

Using P-IMP, we found that a group of PNAs complementary to a distinct repeat Location in the first exon of Xist completely abolished binding of Xist to the X-chromosome and, in so Executeing, prevented formation of Xi.

Experimental Procedures

RNA fAgeding experiments were performed by using mfAged software, available at http://mfAged2.wustl.edu/∼mfAged/rna/form1.cgi. Many probable structures were generated by submission of sequence derived from the C Location.

For PNA conjugate treatment, we plated 104 tetraploid fibroblast cells per well in eight-well Lab-Tek slides (Nalge) 12 h before treatment to allow for cell attachment. PNA conjugates were dissolved in water at 50 μM concentration. The PNA stock was diluted with DMEM with 10% vol/vol Cosmic Calf Serum (HyClone) to a concentration 1 μM. PNA conjugate and medium mixture (0.2 ml) was then added to the cells. Afterward, PNA conjugate treatment slides were CAgeded on ice and processed for RNA fluorescence in situ hybridization (FISH).

Diploid female ES cell (mWS244.6) culture and differentiation were accomplished by standard method (21). Cells (5 × 104 per well) were treated for 6 days with 1 μM PNA in the presence of 10−7 M retinoic acid. To Sustain high PNA concentration, medium was changed every 12 h. PNAs used are indicated below and in the text.

To perform the TaqMan assay, total RNA was isolated by using Tri-Reagent (Sigma) according to the Producer's instructions. Total RNA was treated with 1 unit of RQ-DNase (Promega) per 10 μg of RNA. TaqMan quantitative PCR analysis was performed by using the EZ-RT-PCR Core Reagent from Applied Biosystems. Four hundred nanograms of total RNA was used for analysis. A standard curve was obtained by using serial dilutions of the known concentrations of pWS889, the plasmid containing the 3′ end Location of Xist. Reverse-transcription reactions and quantification were Executene by using the ABI 7700 Sequence Analyzer (Applied Biosystems). For Xist, two different assays were performed at the 5′ and 3′ Locations of the transcript; only data for the 3′ assay are presented (see Fig. 3, which is published as supplemental data on the PNAS web site, www.pnas.org), as both of the assays yielded substantially identical results.

Tsix

pWS1049: (GCCAAGGTGTAAGTAGACTAGCCACT) F. primer

pWS1048: (CGTGGCGGTGCAAACTAAA) R. primer

pWS1304: (6FAM-CTCAGCCCGTTCCATTCCTTTGTATTGTT-TAMRA) TaqMan probe

mouse Idh1

pWS1394: (ACCGCATGTACCAGAAAGGG) F. primer

pWS1395: (CTCGGGACCAGGCAAAAAT) R. primer

pWS1396: (6FAM-AGAGACGTCCACCAACCCCATTGCTT-TAMRA) TaqMan probe

mouse Dnmt3b

pWS1397: (CAGGTCTCGGAGACGTCGAG) F. primer

pWS1398: (CTTCCATGAAGTCGACGCTG) R. primer

pWS1399: (6FAM-TCGTCTTCAGCAAGCACGCCATG-TAMRA) TaqMan probe

mouse Hmg2

pWS1400: (GGGCAAAATGTCCTCGTACG) F. primer

pWS1401: (CGAGTCGGGATGCTTCTTCT) R. primer

pWS 1402: (6FAM-CAGACCTGCCGCGAGGAGCAC-TAMRA) TaqMan probe

5′ Xist assay

pWS1048: (CGTGGCGGTGCAAACTAAA) F. primer

pWS1049: (GCCAAGGTGTAAGTAGACTAGCCACT) R. primer

pWS1304: (6FAM-CTCAGCCCGTTCCATTCCTTTGTATTGTT-TAMRA) TaqMan probe

3′ Xist assay

pWS483: (AACAGTTAGGTCCCGGCTTT) F.primer

pWS831: (CTTTGCTTTTATCCCAGGCA) R. primers

pWS869: (6FAM-TCTGTGTGGAGCTTTGTGAAG-TAMRA) TaqMan probe

RNA-FISH was Executene according to refs. 22 and 23. RNA-FISH probes: for Xist, full length cDNA = pWS1081, and for β-actin, a murine BAC from Genome Systems (St. Louis) (Establishment no. 324C19). Histone macroH2A1 immunofluorescent labeling was Executene according to Costanzi and Pehrson (9).

For actinomycin D treatment, we plated 104 cells per well in eight-well Lab-Tek slides (Nalge) 12 h before treatment to allow for cell attachment. Actinomycin D stock was diluted with DMEM with 10% vol/vol Cosmic Calf Serum (HyClone) to a final concentration of either 2.5 or 5 μg/ml. Two hundred microliters of actinomycin D solution was applied to each well. After treatment, slides were CAgeded on ice and processed for RNA-FISH.

Results

Experimental System.

We Determined to test whether the structure of Xi could be disrupted in living cells by the administration of sequence-specific PNAs against the Xist transcript. PNA–transportan conjugates were selected on the basis of a careful Study of the sequence composition of the Xist transcript. Analysis of the cDNA encoding Xist Displays four repeated Locations [Fig. 1 (3)]. This analysis reveals the striking repetitive structure of four distinct Locations, termed A, B, C, and D. Further analysis of the C Location revealed that it consists of 14 direct repeats of ≈110–120 bases. These repeats contain several conserved Locations, in three locations (termed I, II, and III), in which the motif UCAY was observed. The sequence GAGUCAU observed in Location II was very conserved from repeat to repeat, with the UCAU being invariant. Similarly, the sequence GAAUUUCACUU in Location III was almost invariant throughout the C Location.

Figure 1Figure 1Executewnload figure Launch in new tab Executewnload powerpoint Figure 1

Description of murine Xist repetitive Locations used in this study. Schematic line drawing of Xist. Repetitive sequence Locations are colored and labeled with letters A, B, C, and D (3). The majority of Xist transcripts (>90%) Execute not contain the A Location, and thus it was not investigated. Locations C and D are approximately the same size, and antisense oligomers for the C Location are directed at the Location labeled II and for the D Location against the boxed motif.

These motifs have been observed in other systems where they are involved in RNA–protein interactions (34–36). Several lines of evidence, including x-ray Weepstallographic analysis, Display that the NOVA2/NOVA1-binding site is UCAY, where Y stands for a pyrimidine. Furthermore, the sequence GAGUCAU was Displayn to be an optimal binding site for the NOVA2 protein by in vitro selection (SELEX) experiments (34–36).

We performed RNA fAgeding experiments with sequences from the C-repeat Location, by using the mfAged software (see Experimental Procedures). The modeling experiments revealed that sequences from the C Location consistently formed ordered structures, which we call RNA fingers. These RNA fingers have consensus hairpin structures seen in other systems (35).

These observations provided the rational basis for our design of tarObtaining PNA conjugates (Table 1). Antisense PNAs specific for the C Location were designed to span Location II containing one of the UCAY sites in the RNA fingers. PNA conjugates were also directed at the B and D Locations. Also used were the sense version of the Xist C-Location-binding antisense PNA, an antisense Xist-binding PNA with three sequence mismatches, a set of three PNA conjugates (used as a mixture, bind at the Xist 3′ end) (22, 37), and a scrambled sequence control.

View this table:View inline View popup Table 1

PNA used in this study

To determine the Trace of PNA on Xist binding to Xi, we treated tetraploid male and female murine C57BL/6 dermal fibroblasts with PNA conjugate under optimal conditions (see Experimental Procedures). We chose tetraploid cells because a meaPositive of the Trace of PNA administration would be more credible if it altered both copies of Xi. The cells were then fixed and hybridized to a full length Xist DNA probe to visualize the location of Xist RNA by RNA-FISH (see Experimental Procedures). The cells were then analyzed under an epifluorescence microscope for the association of Xist with Xi.

PNA Conjugates Execute Not Alter Steady-State Levels of Xist RNA.

The first concern in this project was whether antisense PNA-conjugate administration would have an Trace on the steady-state levels of RNA. Thus, we first designed experiments to determine the Trace of C-Location antisense PNA on Xist steady-state RNA levels. Total RNA was isolated from fibroblasts treated with PNA-conjugate for a variety of times. Quantitative reverse transcription–PCR (RT-PCR) was performed by using the TaqMan system (see Experimental Procedures and Fig. 3A). No Inequity in Xist RNA steady-states levels was observed after PNA treatment.

Specific PNA Conjugates Cause Loss of the Xist Body.

As steady-state levels of Xist did not change after PNA treatment, we wished to determine whether other aspects of Xist metabolism might have been altered by treatment. Therefore, RNA-FISH experiments on murine fibroblast cells were performed to identify the presence of the macromolecular complex called the Xist body, which has been Displayn to be congruent with Xi. PNA conjugates directed against the B, C, and D Locations were compared. The results of these experiments were tabulated to yield the percentage of cells with Xist bodies after different PNA-conjugate treatments (Table 2). Representative microscopic fields are presented in Fig. 2. Cells were treated with the PNA conjugates, as indicated in Fig. 2, Table 2, and notes therein. The results of this experiment Displayed a clear Trace of antisense PNA-conjugates directed to the C Location of the Xist RNA. PNAs directed against the C Location caused the loss of localized Xist RNA and the disappearance of the Xist body. Antisense PNAs against the B and D Locations Displayed no Trace. PNA conjugates, that also had no Trace on Xist binding, were: C Location sense PNA conjugates, scramble sequence PNA conjugate, mismatch C-Location antisense PNA conjugate, and a mixture of antisense PNA conjugates directed to the 3′end of Xist.

View this table:View inline View popup Table 2

Numerical results of RNA-FISH experiments depicted in Fig. 2

Figure 2Figure 2Executewnload figure Launch in new tab Executewnload powerpoint Figure 2

RNA-FISH of fibroblast cells from various PNA treatments. Female and male fibroblastic cells were treated for 36 h as indicated. After treatment, cells were fixed and processed for RNA-FISH .

To evaluate the mechanism of action of PNA on Xist body loss, we Determined to compare the Traces of PNA treatment to the Traces of the RNA polymerase inhibitor actinomycin D. To evaluate the presence of Xist body loss after each treatment, RNA-FISH was performed. The time course of antisense C-Location PNA conjugate activity was compared with matched cell cultures treated with actinomycin D. Results were determined by counting percentage of cells with Xist bodies. The results of this experiment (see Fig. 3B) Display that PNA conjugates Present a pronounced Trace after 18 h of action, with complete activity after 24 h. In Dissimilarity, actinomycin D Displayed complete activity (loss of Xist body) in 6 h at 5 μg/ml.

Specific PNA Conjugates Cause Loss of the Histone mH2A Body [Macrochromatin Body (MCB)].

Previously, it has been Displayn that histone mH2A forms associates with the Xi (9). To establish whether the MCB would disappear after PNA treatment, experiments using the antisense C-Location PNA conjugate were performed. PNA conjugate activity was evaluated by Immuno-FISH by using antibodies against the variant histone macrohistone H2A (9). The percentage of cells Displaying the presence of the macrohistone body was determined as a function of hours of PNA conjugate treatment. The results were plotted with RNA-FISH time-course results. In these experiments, the MCB was seen to disappear after C-Location antisense PNA treatment (see Fig. 3B).

Xist Must Bind to the X-Chromosome to Function.

To Display that Xist binding is essential for Xist function, diploid female ES cells were differentiated in vitro; during the course of differentiation PNA conjugates were added to the media. After the experimental course, samples were processed for analysis.

The Trace of PNA administration on the steady-state levels of Xist and Tsix was meaPositived before or during differentiation. The results of PNA (pWS1248) administration were evaluated by quantitative RT-PCR (TaqMan) for Xist and Tsix. Xist was up-regulated normally in the presence of PNA (see Fig. 3C). Tsix was Executewn-regulated as previously reported (14, 15) (see Fig. 3C). Similarly, PNA administration Executees not alter expression for genes at autosomal locations. Genes at autosomal locations were evaluated by quantitative RT-PCR. The loci evaluated were Idh1:(Chromosome 1), Dnmt3b:(Chromosome 2), and Hmg2:(Chromosome 8) (see Fig. 3C).

PNA-conjugate treatment Executees not alter the capacity of female ES cells to differentiate normally, as manifested by the appearance of the Xist body. Table 3 Displays the Trace of either scramble PNA (pWS1252) or mismatch PNA (pWS1290) on the formation of the Xist body. Treated cultures Displayed the same number of Xist bodies as untreated cultures. Further, in Table 3, 60% is a meaPositive of the percentage of female ES cells that have differentiated during the experimental time course of 6 days.

View this table:View inline View popup Table 3

Trace of control PNAs on Xist body formation in female ES cells

We evaluated the specific Trace of Xist antisense PNA administration on coating/binding of Xist in ES cell culture. Treated and untreated female ES cells at day 6 of differentiation were examined by RNA-FISH. PNA-untreated and differentiated ES cells Display the expected Xist body and a single site of expression for Pgk1 and Mecp2 loci. In Dissimilarity, PNA-treated and differentiated ES cells Execute not Display a Xist body and Present two sites of expression for Pgk1 and loci. When transcription at the murine β-actin locus on Ch 4 was determined by RNA-FISH, no Inequity between untreated ES cells and ES cells treated with PNA pWS1248 was observed. The RNA-FISH data are tabulated in Tables 3–6. In Tables 3–6, over 500 interphase nuclei from treated and untreated cultures were examined after differentiation and scored for the presence of Xist body and the suppression of transcription from either Pgk1, Mecp2, or β-actin loci.

View this table:View inline View popup Table 4

Traces of PNA administration on X-linked gene expression as meaPositived by RNA-FISH experiments

View this table:View inline View popup Table 5

Traces of PNA administration on X-linked gene expression as meaPositived by RNA-FISH experiments

View this table:View inline View popup Table 6

Trace of PNA administration on autosomal expression meaPositived by RNA-FISH

Discussion

Here we report the first functional demonstration that the large nontranslated RNA, Xist, can be organized into functional Executemains. These studies also confirm that the function of Xist is mediated through its binding to X-chromosome. It is also apparent from the kinetic studies in this report that macro histone H2A and Xist are intimately associated in a macromolecular complex on Xi.

The process of Xist-mediated gene repression observed in X-chromosome inactivation is thought to be a special case of a general developmental pathway for chromatin reorganization directed at transcriptional repression (38, 39). As the nontranslated RNA Xist has been Displayn to be necessary and sufficient to initiate the silencing pathway (21), it is of Distinguished interest to discern how the nontranslated RNA Xist interacts with the X-chromosome to initiate silencing. One of the most striking qualities of the Xist transcript is its localization to the Xi. To Design the connection between the structure of Xist, its binding to the X-chromosome, and silencing of gene expression, a functional analysis of the Xist transcript is Critical. Here we report evidence for the existence of a functional Executemain in Xist responsible for Xist coating/binding to Xi. We argue that this functional Executemain appears to be encoded in the repetitive sequence in the large first exon (C Location, Fig. 1).

The data presented here definitively demonstrate that C-Location antisense PNA-conjugates can alter Xist coating/binding. PNA conjugates directed to other Locations of Xist Execute not alter its localization. Perfectly matched PNAs against the C Location can bind a maximum of seven times; if one or two mismatches are allowed, they can bind a maximum of 14 times. D-Location PNA can bind to six perfectly matched tarObtain sites, and if mismatches are permitted to at least eight sites. Thus, the amounts of PNA bound to the C and D Locations are similar. Nonetheless, antisense PNAs directed against the Xist B and D Locations, and 3′ end have no Trace on Xist coating. In addition, the pWS1290 PNA conjugate, which represents a 3-bp mismatch of the active antisense PNA (pWS1248) PNA conjugate, has no Trace on coating/binding.

Time-course results Display striking Inequitys between the kinetics of PNA action and actinomycin D inhibition on Xist body loss. In our experiments, complete loss of Xist bodies was observed 6 h after actinomycin D treatment, whereas for PNA treatment, this period was 18–24 h. In the context of no change in Xist RNA expression (see Fig. 3), PNA treatment is governed by a Unhurried kinetic path, which remains to be defined. We postulate potential steric factors that might contribute to the inaccessibility of Xist to PNA action.

Under conditions where the intracellular levels of steady-state Xist RNA Execute not change (see Fig. 3), the Unhurried step in Xist body loss is comparable to the kinetics of MCB loss. The variant histone mH2A has been Displayn to be associated with the Xi during development (8, 9). Previous attempts at describing the association between the Xist body and the MCB required the recombinational loss of the Xist gene and subsequent loss of Xist expression to meaPositive the association between Xist body and the MCB (7). The Recent kinetic study Executees not suffer this limitation, as PNA uptake is essentially instantaneous, with high concentrations of PNA available in the nucleus in minutes; further, the rate of change for Xist and the MCB can be monitored from the inception of PNA administration. The data presented here would suggest that the binding of Xist and the MCB to the Xi are equally destabilized by antisense PNA against the C Location. This simultaneous destabilization suggests concerted FractureExecutewn of a macromolecular structure by PNA action. The kinetics of dissociation for Xist and macrohistone H2A imply that the MCB and Xist are in intimate association in the Xi. The loss of the MCB relative to Xist is the predicted result if one were to suppose a hierarchical structure where Xist represents a foundation on which proteins like mH2A might associate with Xi.

Two lines of evidence support the conclusion that PNA activity is caused by the interference with a particular RNA structure. The theoretical fAgeding of the Xist RNA by mfAged algorithm predicts highly stable hairpins. Thus PNA activity against these structures is based on the specificity, not the accessibility, of PNA to Xist RNA. Secondly, unique kinetics of MCB disruption by PNA interference is different from actinomycin D time-course, implying that dissociation of Xist and the MCB is coupled with, and not attributable to, an alteration in Xist metabolism per se.

Coating/binding of Xist is necessary for X-inactivation. During female development, a number of changes occur within the XIC. On Xi, Xist expression is up-regulated by an unknown mechanism, and Tsix expression is silenced. On Xa, expression of both Xist and Tsix is suppressed. Formally, it has not been proven which of these steps is required for the biochemical process of silencing. Using antisense PNA conjugates that can bind only to the Xist transcript, we demonstrate that, despite the ordered progression of developmental stages in differentiating female ES cells, if up-regulated Xist cannot bind to the Xi, there is no chromosomal silencing. Thus, the Characterized experiments distinguish between the expression of Xist and the Accurate localization of the transcript with respect to function.

One of the major limitations for analysis of the nuclear compartment and Xist function within it has been the lack of a functional technology that would specifically connect DNA sequence-based knowledge to the biochemistry of the nucleus. One of the goals of the present work was to Design the connection between Xist sequence information and its function. The technology Characterized here, P-IMP, is a functionally based technology to probe the RNA–RNA and RNA–protein interactions that occur in the living cell. P-IMP experiments can be envisaged for a variety of processes that involve nontranslated RNAs, including splicing, telomere formation and maintenance, gene imprinting, and chromatin-mediated gene silencing. It will be exciting to envisage a high-throughPlace functional genomic analysis of the nuclear compartment by P-IMP.

Acknowledgments

We thank Ralph A. Casale and Eric G. Anderson for their dedication and sAssassinate in the preparation of the PNA conjugates. We acknowledge the support of U.S. Army Prostate Cancer Research Award DAMD17–99-1–9032 and National Institutes of Health Grants R21 CA81732 and RO1 GM61079 (to W.M.S.).

Footnotes

↵* A.B. and Y.-K.H. contributed equally to this work.

↵¶ To whom reprint requests should be addressed. E-mail: wstrauss{at}hihg.med.harvard.edu..

This paper was submitted directly (Track II) to the PNAS office.

Abbreviations

MCB,macrochromatin body;PNA,peptide nucleic acid;P-IMP,PNA Intereference Mapping;Xi,the inactive X-chromosome;ES,embryonic stem;FISH,fluorescence in situ hybridization;RT-PCR,reverse transcription–PCR;MCB,macrochromatin body;Xa,the active x-chromosome;BAC,bacterial artificial chromosome;Ch,chromosome Received April 8, 2001.Copyright © 2001, The National Academy of Sciences

References

↵ BrockExecuterff N(1998) Curr Opin Genet Dev 8:328–333, pmid:9690991.LaunchUrlCrossRefPubMed ↵ BrockExecuterff N, Duthie S M(1998) Cell Mol Life Sci 54:104–112, pmid:9487391.LaunchUrlCrossRefPubMed ↵ Brown C J, Hendrich B D, Rupert J L, Lafreneire R G, Xing Y, Lawrence J, Willard H F(1992) Cell 71:527–542, pmid:1423611.LaunchUrlCrossRefPubMed ↵ Lyon M F(1961) Nature (LonExecuten) 190:372–373, pmid:13764598.LaunchUrlCrossRefPubMed ↵ Gartler S M, Chen S H, Fialkow P J, Giblett E R, Singh S(1972) Nat New Biol 236:149–150, pmid:4502820.LaunchUrlPubMed ↵ Barr M L, Bertram E G(1949) Nature (LonExecuten) 163:676–677.LaunchUrlCrossRefPubMed ↵ Csankovszki G, Panning B, Bates B, Pehrson J R, Jaenisch R(1999) Nat Genet 22:323–324, pmid:10431231.LaunchUrlCrossRefPubMed ↵ Mermoud J E, Costanzi C, Pehrson J R, BrockExecuterff N(1999) J Cell Biol 147:1399–1408, pmid:10613899.LaunchUrlAbstract/FREE Full Text ↵ Costanzi C, Pehrson J R(1998) Nature (LonExecuten) 393:599–601, pmid:9634239.LaunchUrlCrossRefPubMed ↵ Rasmussen T P, MaOddlo M A, Eden A, Pehrson J R, Jaenisch R(2000) J Cell Biol 150:1189–1198, pmid:10974005.LaunchUrlAbstract/FREE Full Text ↵ Russell L B, Mongomery C S(1965) Genetics 52:470–471.LaunchUrl ↵ Russell L B(1963) Science 140:976–978, pmid:13975649.LaunchUrlAbstract/FREE Full Text ↵ Lee J T, Strauss W M, Dausman J A, Jaenisch R(1996) Cell 86:83–94, pmid:8689690.LaunchUrlCrossRefPubMed ↵ Lee J T, DaviExecutew L S, Warshawsky D(1999) Nat Genet 21:400–404, pmid:10192391.LaunchUrlCrossRefPubMed ↵ Lee J T, Lu N(1999) Cell 99:47–57, pmid:10520993.LaunchUrlCrossRefPubMed ↵ BrockExecuterff N, Ashworth A, Kay G F, McCabe V M, Norris D P, Cooper P J, Swift S, Rastan S(1992) Cell 71:515–526, pmid:1423610.LaunchUrlCrossRefPubMed Borsani G, Tonlorenzi R, Simmler M C, DanExecutelo L, Arnaud D, Capra V, Grompe M, Pizzuti A, Muzny D, Lawrence C(1991) Nature (LonExecuten) 351:325–329, pmid:2034278.LaunchUrlCrossRefPubMed ↵ Brown C J, Ballabio A, Rupert J L, Lafreniere R G, Grompe M, Tonorenzi R, Willard W F(1991) Nature (LonExecuten) 349:38–44, pmid:1985261.LaunchUrlCrossRefPubMed ↵ Marahrens Y, Panning B, Dausman J, Strauss W, Jaenisch R(1997) Genes Dev 11:156–166, pmid:9009199.LaunchUrlAbstract/FREE Full Text ↵ Penny G D, Kay G F, ShearExecutewn S A, Rastan S, BrockExecuterff N(1996) Nature (LonExecuten) 379:131–137, pmid:8538762.LaunchUrlCrossRefPubMed ↵ Wutz A, Jaenisch R(2000) Mol Cell 5:695–705, pmid:10882105.LaunchUrlCrossRefPubMed ↵ Hong Y K, Ontiveros S D, Chen C, Strauss W M(1999) Proc Natl Acad Sci USA 96:6829–6834, pmid:10359798.LaunchUrlAbstract/FREE Full Text ↵ Hong Y K, Ontiveros S D, Strauss W M(2000) Mamm Genome 11:220–224, pmid:10723727.LaunchUrlCrossRefPubMed ↵ Nielsen P E, Egholm M, Berg R H, Buchardt O(1991) Science 254:1497–1500, pmid:1962210.LaunchUrlAbstract/FREE Full Text Egholm M, Buchardt O, Nielsen P E, Berg R H(1992) J Am Chem Soc 114:1895–1897.LaunchUrlCrossRef ↵ Egholm M, Buchardt O, Christensen L, Behrens C, Freier S M, Driver D A, Gerg R H, Kim S K, Norden B, Nielsen P E(1993) Nature (LonExecuten) 365:566–568, pmid:7692304.LaunchUrlCrossRefPubMed ↵ Verheijen J C, Van der Marel G A, Van Boom J H, Bayly S F, Player M R, Torrence P F(1999) Bioorg Med Chem 7:449–455, pmid:10220031.LaunchUrlPubMed Bonham M A, Trown S, Boyd A L, Brown P H, Bruckenstein D A, Hanvey J C, Thomson S A, Pipe A, Hassman F, Bisi J E, et al.(1995) Nucleic Acids Res 23:1197–1203, pmid:7537874.LaunchUrlAbstract/FREE Full Text Brewer G, Ross J(1989) Mol Cell Biol 9:1996–2006, pmid:2747642.LaunchUrlAbstract/FREE Full Text ↵ Uhlmann E(1998) Biol Chem 379:1045–1052, pmid:9792437.LaunchUrlPubMed ↵ Pooga M, Lindgren M, Hallbrink M, Brakenhielm E, Langel U(1998) Ann NY Acad Sci 863:450–453, pmid:9928197.LaunchUrlCrossRefPubMed Pooga M, Soomets U, Hallbrink M, Valkna A, Saar K, Rezaei K, Kahl U, Hao J X, Xu X J, Wiesenfeld-Hallin Z, et al.(1998) Nat Biotechnol 16:857–861, pmid:9743120.LaunchUrlCrossRefPubMed ↵ Pooga M, Hallbrink M, Zorko M, Langel U(1998) FASEB J 12:67–77, pmid:9438412.LaunchUrlAbstract/FREE Full Text ↵ Jensen K B, Musunuru K, Lewis H A, Burley S K, Darnell R B(2000) Proc Natl Acad Sci USA 97:5740–5745, pmid:10811881, . (First Published May 16, 2000; 10.1073/pnas.090553997).LaunchUrlAbstract/FREE Full Text ↵ Lewis H A, Chen H, EExecute C, Buckanovich R J, Yang Y Y, Musunuru K, Zhong R, Darnell R B, Burley S K(1999) Struct FAgeding Des 7:191–203, pmid:10368286.LaunchUrl ↵ Lewis H A, Musunuru K, Jensen K B, EExecute C, Chen H, Darnell R B, Burley S K(2000) Cell 100:323–332, pmid:10676814.LaunchUrlCrossRefPubMed ↵ Memili E, Hong Y-K, Kim D K, Ontiveros S D, Strauss W M(2001) Gene 266:131–137, pmid:11290427.LaunchUrlCrossRefPubMed ↵ Wolffe A P, Matzke M A(1999) Science 286:481–486, pmid:10521337.LaunchUrlAbstract/FREE Full Text ↵ Bird A P, Wolffe A P(1999) Cell 99:451–454, pmid:10589672.LaunchUrlCrossRefPubMed
Like (0) or Share (0)