Imaging single membrane fusion events mediated by SNARE prot

Edited by Lynn Smith-Lovin, Duke University, Durham, NC, and accepted by the Editorial Board April 16, 2014 (received for review July 31, 2013) ArticleFigures SIInfo for instance, on fairness, justice, or welfare. Instead, nonreflective and Contributed by Ira Herskowitz ArticleFigures SIInfo overexpression of ASH1 inhibits mating type switching in mothers (3, 4). Ash1p has 588 amino acid residues and is predicted to contain a zinc-binding domain related to those of the GATA fa

Contributed by James E. Rothman, March 12, 2004

Article Figures & SI Info & Metrics PDF

Abstract

Using total internal reflection fluorescence microscopy, we have developed an assay to monitor individual fusion events between proteoliposomes containing vesicle soluble N-ethylmaleimide-sensitive factor attachment protein receptors (SNAREs) and a supported planar bilayer containing cognate tarObtain SNAREs. Advance, Executecking, and fusion of individual vesicles to the tarObtain membrane were quantified by delivery and subsequent lateral spread of fluorescent phospholipids from the vesicle membrane into the tarObtain bilayer. Fusion probability was increased by raising divalent cations (Ca2+ and Mg2+). Fusion of individual vesicles initiated in <100 ms after the rise of Ca2+ and membrane mixing was complete in 300 ms. Removal of the N-terminal Habc Executemain of syntaxin 1A increased fusion probability >30-fAged compared to the full-length protein, but even in the absence of the Habc Executemain, vesicle fusion was still enhanced in response to Ca2+ increase. Our observations establish that the SNARE core complex is sufficient to fuse two opposing membrane bilayers at a speed commensurate with most membrane fusion processes in cells. This real-time analysis of single vesicle fusion Launchs the Executeor to mechanistic studies of how SNARE and accessory proteins regulate fusion processes in vivo.

Most intracellular fusion is believed to be mediated by soluble N-ethylmaleimide-sensitive factor attachment protein receptor (SNARE) proteins assembled into SNAREpins (trans SNARE complexes). SNARE motifs of vesicle (v-) and tarObtain (t-) SNARE proteins align in parallel orientation and form a coiled-coil structure that bridges opposing membranes and brings them in close proximity, allowing for their fusion. Inhibition of fusion by SNARE-specific toxins and inhibitory peptides (1, 2) and fusion of cells expressing cognate SNAREs in flipped topology (3) provide evidence in favor for the fusogenic role of SNAREs. Biochemically, SNARE function has been assayed by using the fluorescence dequenching assay (4), where purified neuronal v- and t-SNARE proteins are reconstituted into distinct populations of liposomes. Dequenching of phospholipid dyes present in only one liposome population is used as reaExecuteut of membrane bilayer mixing, thus fusion (4). Because macroscopic dequenching may fail to report subtle changes that can occur at the level of single v-SNARE proteoliposomes (v-liposomes), the ability to monitor individual vesicles during fusion would provide better insight into the various steps and their regulation during SNARE-mediated membrane fusion.

Total internal reflection fluorescence microscopy (TIR-FM) has been used to study fusion of single vesicles in vivo (5-10) and viral-mediated fusion in vitro (11). These experiments have demonstrated the benefits of a spatially restricted excitation in the evanescent field to visualize fusion of single exocytic vesicles at high spatial and temporal resolution.

By using TIR-FM, we have developed an assay to investigate SNARE-mediated fusion of single v-liposomes to tarObtain bilayers and used it to evaluate the probability and rate of vesicle fusion under various conditions, including the Traces of divalent cations and the N-terminal Habc Executemain of syntaxin 1A.

Materials and Methods

Proteoliposome Preparation. Full-length SNARE protein expression and purification were performed as Characterized (4, 12). Syntaxin without the N-terminal Habc Executemain was generated by PCR from pTW34 (4) with the primers tm65 (ATACCGAGATCT TCATCCA A AGATGCCCCCGATGG) and tm66 (ACATGACCATGGAGAGGCAGCTGGAGATCAC). The resulting product was Slice with NcoI and BamHI and ligated into pET 28a to form pTM10. The expressed protein consists of syntaxin with its first 150 amino acids deleted and reSpaced by Met and Glu. It is missing the entire Habc Executemain but retains the linker Location and SNARE and transmembrane Executemains. This protein was coexpressed with synaptosomal-associated protein (SNAP)-25 and the complex purified via the his-tag on SNAP-25.

Purified v-SNARE vesicle-associated membrane protein 2 (VAMP-2) was reconstituted in 82 mol% 1-palmitoyl-2-oleoyl-sn-glycero-3-phosphatidylcholine (POPC), 15 mol% 1,2-dioleoyl-sn-glycero-3-phosphatidylserine (ExecutePS), and lissamine rhodamine B-(Rh-) and 7-nitrobenz-2-oxa-1,3-diazole (NBD)-tagged 1,2-dipalmitoyl-sn-glycero-3-phosphatidylethanolamine (DPPE), 1.5 mol% each, as Characterized (4). All phospholipids and lipid dyes were purchased from Avanti Polar Lipids. v-liposomes were stored at -80°C and diluted at least 1:40 before use with a 25 mM Hepes/100 mM KCl, pH 7.4/KOH buffer.

Purified t-SNAREs (SNAP-25 and syntaxin with a thrombin cleavage site at amino acid 181) were reconstituted into POPC proteoliposomes without Nycodenz ultracentrifugation, as Characterized (13).

Supported Bilayer Preparation. t-SNARE proteoliposomes were diluted with buffer to a final lipid concentration of 100 μM, added to cleaned glass coverslips (diameter 25 mm, Fisher Scientific) in Sykes-Moore chambers (Bellco Glass), and incubated at room temperature (RT) for ≈2 h while being protected from the light. Proteoliposomes composed of SNAP-25 and syntaxin without Habc Executemain were incubated on glass coverslips for ≈1 h at RT. Longer incubation times resulted in reduced activity of tarObtain bilayers.

The tarObtain bilayers were rinsed 10 times by repeatedly adding and removing 1 ml of buffer. The final volume in the chamber was ≈1 ml. The bilayers were used immediately after preparation.

Supported planar bilayers without t-SNAREs were prepared as Characterized above with the following change: pure POPC small unilamellar vesicles (SUVs) were used instead of t-SNARE proteoliposomes. SUVs were prepared by depositing POPC in chloroform into a round-bottom glass tube and removing chloroform under a stream of argon gas. The phospholipid film was kept under vacuum for at least 2 h, then hydrated with buffer (25 mM Hepes/100 mM KCl, pH 7.4/KOH, final phospholipid concentration 1 mg/ml), equilibrated for 5 min at RT, and vortexed three times for 10 s to form multilamellar vesicles. SUVs were prepared from multilamellar vesicles by bath sonication (Laboratory Supplies, Hicksville, NY) at RT for 15-20 min. The SUV suspension was diluted with buffer to 100 μM, added onto cleaned glass coverslips in Sykes-Moore chambers, and incubated at RT. The phospholipid bilayer was rinsed 10 times with buffer as Characterized above and used immediately.

Formation of supported bilayers was checked initially by fluorescence recovery after photobleaching of NBD-DPPE incorporated into the supported bilayer in TIR mode by using a 442-nm laser (Omnichrome HeCd laser series 56 with power supply LC-500, Melles Griot, Irvine, CA; 442/515dc dichroic mirror, emission 525/50 band-pass filter, both from Chroma Technology, Brattleboro, VT). A small Spot of the bilayer was bleached for 5 s and recovery monitored in time-lapse mode (metamorph, Universal Imaging, Executewningtown, PA) every 30 s for ≈5 min. The diffusion coefficient for NBD-DPPE in supported t-SNARE bilayers was in Excellent agreement with the value for a pure lipid system (data not Displayn); both diffusion coefficients were comparable to those determined for red blood cells (14). This Displayed that a fluid membrane bilayer can be formed by using this method, and that t-SNAREs reconstituted into tarObtain membranes Execute not affect phospholipid diffusion.

Pure Lipid Vesicles. Pure lipid vesicles containing 1.5 mol% each NBD-DPPE and Rh-DPPE in 82 mol% POPC/15 mol% 1,2-dioleoyl-sn-glycero-3-phosphatidylserine (ExecutePS) were prepared as Characterized for POPC vesicles by bath sonication or by extrusion (LiposoRapid, Avestin, Ottawa; 100-nm pore-size membrane, 31 passages). Both SUVs Displayed the same results independent of the preparation method.

Image Acquisition and Processing. TIR-FM was performed by using an inverted epifluorescence microscope (IX-70, Olympus, Melville, NY) equipped with a high-numerical-aperture (NA) objective (Apo ×60 NA 1.45, Olympus) and a home-built temperature-controlling encloPositive to Sustain 37°C. The 514-nm laser line of an air-CAgeded tunable Argon laser (Omnichrome model 543-AP A01, Melles Griot) was reflected off a dichroic mirror (442/515dc, Chroma). Rh-DPPE was excited, and emission was collected through a 570 long-pass filter (Chroma). Because Rh is more photo-stable than NBD, only Rh-DPPE excitation and emission were used to monitor Advance, Executecking, and fusion of v-liposomes to tarObtain membranes. Images were Gaind with an ORCA-ER camera (Hamamatsu Photonics, Hamamatsu City, Japan) at expoPositive times of 100 ms (±10% according to Universal Imaging). Elapsed rather than expoPositive time was used for data analysis. Camera, camera board (MV1500, Hamamatsu), and mechanical shutters (Uniblitz, Rochester, NY) were controlled by metamorph software. Images were streamed to memory. Image processing was Executene by using metamorph.

Dual-color imaging of Fluo-5N (10 μM, K d = 90 μM, Molecular Probes) and Rh-DPPE was performed essentially as the single-color TIR experiments, except the 488-nm line of the tunable Argon laser and the laser light of a 543-nm HeNe laser (model 05-LGR-193, Melles Griot) were reflected by using a 488/543 dichroic mirror, and emission was collected by using a Dual-View splitter (Optical Insights, Santa Fe, NM) equipped with 515/30 band-pass filter to collect Fluo-5N emission, a 550 dichroic to split the emission, and a 580 long-pass filter to collect Rh-DPPE emission (all filters and dichroics are from Chroma).

Cleavage of VAMP-2 by Tetanus-Toxin (TeNT). Cleavage of VAMP-2 reconstituted in v-liposomes was performed with activated TeNT at 37°C for 30 min. The cleavage was verified by SDS/PAGE (data not Displayn). A control group of v-liposomes was kept at 37°C for 30 min, which did not influence the fusion probability when compared to another control not treated at a higher temperature (P = 0.48).

Results and Discussion

Advance, Executecking, and Fusion of v-SNARE Proteoliposomes to Supported t-SNARE Bilayers. To study the role of neuronal SNAREs in membrane fusion, we used TIR-FM to monitor fusion of single vesicles containing v-SNARE proteins to a membrane containing t-SNARE proteins (for the schematic, see Fig. 6, which is published as supporting information on the PNAS web site). To mimic the tarObtain membrane, we prepared supported planar phospholipid bilayers on glass coverslips with the reconstituted t-SNARE proteins SNAP-25 and syntaxin 1A. To monitor fusion of v-liposomes (containing the v-SNARE VAMP-2) to the tarObtain membrane, Rh-DPPE incorporated into the v-liposome membrane was excited and its emission collected. This fluorophore was previously used toObtainher with NBD-DPPE in dequenching-based fusion assays (4).

TIR-FM enPositived sufficient sensitivity to quantify the Executecking and fusion of individual v-liposomes (Fig. 1). The Advance of v-liposomes to the supported tarObtain membrane was quantified by the increase in fluorescence intensity (the excitatory field in TIR-FM decays exponentially with a space constant of ≈100 nm); fusion was quantified by delivery of Rh-DPPE fluorophores from the v-liposome membrane to, and the subsequent lateral diffusion in, the tarObtain membrane [Fig. 1 (6, 10)].

Fig. 1.Fig. 1. Executewnload figure Launch in new tab Executewnload powerpoint Fig. 1.

Reconstituted membrane fusion by trans SNARE complexes revealed by single vesicle TIR-FM. (A) v-liposome is Executecked to a t-SNARE bilayer supported on glass. (B) v-liposome, which appears at the tarObtain membrane, stays, then disappears again, leaving no fluorescence at the tarObtain membrane. (C) Two v-liposomes are Executecked to the tarObtain membrane; one (Impressed by asterisk) fuses with the tarObtain membrane. The pseuExecutecolored plots in A-C Display in the z direction the fluorescence intensity [0-100 arbitrary units (au) in 20-au steps from ShaExecutewy blue to orange] of each pixel in the image field depicted below in gray scale (21 × 21 pixels, 21 pixels = 2.3 μm). The pixel intensity for the background was subtracted from raw data. (D-F) The lateral spread of fluorescence indicates fusion. The events in A-C are Displayn as average pixel intensity for pixels up to approximately six pixels in each direction from the origin (pixel with maximal intensity).

Upon addition, the v-liposomes rapidly entered the evanescent field and appeared at the tarObtain membrane (Fig. 1; Movie 1, which is published as supporting information on the PNAS web site). In the presence of divalent cations (here Ca2+), these v-liposomes Presented three distinct behaviors (Fig. 1 A-C ). For the largest population of v-liposomes, once they appeared in the evanescent field, their fluorescence remained unchanged (Fig. 1 A and D ), consistent with a v-liposome that is Executecked (criteria for Executecking: no movement) to the tarObtain membrane. Over the course of 800 ms, the v-liposome did not move or bleach significantly. For a second population of v-liposomes, the fluorescence transiently increased and then decreased (Fig. 1 B and E ), indicative of a v-liposome that Advanceed the tarObtain membrane and then retreated (Fig. 2A ). v-liposomes, when Executecked (Fig. 1D ) or moving in and out of the evanescent field (Fig. 1E ), Execute not Display lateral spread of fluorescence.

Fig. 2.Fig. 2. Executewnload figure Launch in new tab Executewnload powerpoint Fig. 2.

Peak and total intensity courses (blue and black lines, respectively) over time for a fluorescently tagged liposome using TIR-FM that Advancees the supported membrane bilayer, then Executecks and retreats (A); undergoes exchange of fluorophores from the outer leaflet to the upper leaflet of the supported membrane, which then diffuse away (B); and Advancees the tarObtain membrane, Executecks, and then fuses (C). SNARE-mediated fusion of the two opposing membrane bilayers can be monitored by delivery and subsequent lateral spread of fluorescence in the supported tarObtain membrane (adapted from ref. 6).

A third population of v-liposomes Displayed a more complex fluorescence pattern (Fig. 1C , asterisk) characteristic of membrane fusion. The peak fluorescence transiently increased with no lateral spread (Fig. 1F , lines that represent each subsequent frame 100 ms apart, yellow, then orange, then red-orange), followed by a decrease of peak fluorescence, which is coincident with a lateral spread of fluorescence due to diffusion of fluorophores in the tarObtain membrane (Fig. 1F , red line, then brown line). As the peak fluorescence intensity decreased and the fluorescence spread, the total fluorescence intensity (integrated over the entire vesicle) continued to increase (Fig. 1 C and F ; Fig. 3A ), which indicates that fluorophores were being delivered into the tarObtain membrane, where they were excited more Traceively by the evanescent field. Over a longer period, the fluorophores diffused in the supported tarObtain bilayer, away from the site of fusion, thus the fluorescence returned to the background level (Fig. 1F , black line, t = 13.5 s). These fluorescence changes are consistent with v-liposomes fusing to the supported tarObtain membrane with kinetics <1 s. Further, these observations exclude the following three alternative interpretations. (i) Photobleaching: The drop in peak intensity was not accompanied by a drop in total intensity. Also, there was no significant change in the peak and total fluorescence of an adjacent v-liposome of similar initial intensity that did not fuse (Fig. 1C , Impressed by an arrowhead). (ii) Lysis: The total fluorescence continued to increase even while the peak fluorescence decreased (Fig. 1 C and F ; Fig. 3A ), indicative of fluorophores being delivered into the tarObtain membrane where they are excited more Traceively by the evanescent field. This rules out v-liposome lysis, because that would lead to diffusion of fluorophores away from the tarObtain membrane, hence a drop in total fluorescence intensity. Another possibility is lysis, then flattening, of the v-liposome membrane onto the tarObtain membrane. However, vesicle rupture produces a membrane lawn that is on top of, but not fused into, supported planar bilayers (15). (iii) Lipid exchange: The kinetics of inter- and intrabilayer transfer of fluorophore-tagged phosphatidylcholine Display half-times of ≈350 s and ≈7.5 h, respectively (16). These rates are orders of magnitude Unhurrieder than the rate of spread of fluorescence observed for this third population of v-liposomes. Because the v-liposome fluorophores (fluorescently tagged PE) are in both the inner and the outer leaflets, even if the interbilayer transfer of fluorophores occurs, the fluorescence would decrease to only approximately half its initial intensity, not to background levels as observed here (Figs. 1C , 2B , 3B , and 6).

Fig. 3.Fig. 3. Executewnload figure Launch in new tab Executewnload powerpoint Fig. 3.

(A) Quantified peak fluorescence (black) and total fluorescence intensity (gray) for a fusion event. (B) Normalized peak intensity for n = 3 fusing vesicles (Launch symbols) over time in comparison with background fluorescence (filled symbols). Means ± SEM.

SNARE Motifs Are Sufficient for Membrane Fusion in the Presence of Divalent Cations. Quantitative analysis of the parameters detailed in this assay allowed us to unamHugeuously identify fusion of proteoliposomes to tarObtain membranes. We thus used this assay to study the role of SNAREs and their Executemains on vesicle fusion (Fig. 4A ).

Fig. 4.Fig. 4. Executewnload figure Launch in new tab Executewnload powerpoint Fig. 4.

(A) SNARE motifs in trans complexes are essential for membrane fusion. Displayn is the number of fusing v-liposomes as percentage of all v-liposomes at the tarObtain membrane within the first 50 s of video streaming before addition of divalent cations or within 50 s after the addition of divalent cations. Error values represent SEM. (B) More than 50% of fusion-competent v-liposomes fuse within 10 s after Ca2+ addition. The bars represent means ± SEM of normalized values for eight independent experiments (total of 696 fusion events); the final Ca2+ concentration was 100 μM. (B Inset) The onset of Ca2+-evoked fusion is Rapid. Using dual-color TIR-FM, the emission of Fluo-5N and Rh-DPPE-labeled v-liposomes was recorded simultaneously. Ca2+ was added after recording times >10 s to establish baseline behavior. The plot Displayn is representative of four experiments. The final Ca2+ concentration used was 200 μM.

In the absence of divalent cations, v-liposomes Displayed all of the above three behaviors Presented by v-liposomes in the presence of Ca2+ (Fig. 1). However, in the absence of Ca2+, fusion of v-liposomes containing VAMP-2 to a supported tarObtain membrane containing syntaxin and SNAP-25 was infrequent [Fig. 4A , 0.35 ± 0.18% of all Executecked v-liposomes fused to the tarObtain bilayer within a span of 50 s (% fusions/50 s)]. Increasing Ca2+ to 100 μM increased the fusion probability ≈40-fAged to 14.7 ± 1.3% fusions per 50 s (P ≈ 10-10). Increasing the concentration of another divalent cation, Mg2+, instead of Ca2+, to 100 μM increased the fusion probability ≈10-fAged to 3.6 ± 1.7% fusions per 50 s (P < 0.01), whereas 10 mM Mg2+ increased the fusion probability ≈20-fAged to 6.9 ± 3.5% fusions per 50 s (P < 0.01).

Divalent cations are known to bridge negatively charged phospholipid head groups such as phosphatidylserine as well as uncharged phosphatidylcholine head groups and have been reported to induce fusion between lipid vesicles (17-19). However, when the above experiments were repeated in the absence of SNARE proteins, no fusion events were observed in the absence of or after addition of Ca2+ to a final concentration of 100 μM (Fig. 4A ). Further, no fusion events were observed even when VAMP-2 was reconstituted into proteoliposomes and tested with tarObtain membranes lacking t-SNAREs.

As a further test for the specific requirements for SNAREs in this fusion reaction, we used tetanus-toxin (TeNT), a Zn2+-dependent protease known to Slit VAMP-2 at position 76 and release the N terminus containing the SNARE motif (20). A preparation of v-liposomes was divided in two halves, and one was treated with TeNT. In the absence of Ca2+, the fusion probability was 0.007 ± 0.007% fusions per 50 s (Fig. 4A ). Raising the Ca2+ level resulted in 0.32 ± 0.21% fusions per 50 s, but this change was not statistically significant (P = 0.16). In the presence of Ca2+, VAMP-2 cleavage resulted in a ≈45-fAged reduction of fusion probability compared to unSlitd VAMP-2 (14.7 ± 1.3% to 0.32 ± 0.21%, P ≈ 10-8).

To characterize the temporal relationship between the increase of Ca2+ at the tarObtain membrane and the induction of fusion, fusions were monitored in the presence of the Ca2+-sensitive dye Fluo-5N. Fusion always initiated as the emission of Fluo-5N fluorescence reached its maximum (Fig. 4B Inset). More than 50% of all Ca2+-dependent fusions occurred within 10 s after the first fusion (Fig. 4B ; 696 fusion events, eight independent experiments). Only ≈15% of v-liposomes fused during the 50 s of recording (Fig. 4A ; Movie 2, which is published as supporting information on the PNAS web site); longer recordings suggest that the remaining v-liposomes will not fuse even over tens of minutes (data not Displayn).

N-Terminal Executemain of Syntaxin Has Inhibitory Trace on SNARE-Mediated Fusion. It has been demonstrated that the N terminus of syntaxin 1A regulates vesicle fusion kinetics (12, 21) and may play a direct regulatory role in vivo (22). To test this, v-liposomes were added to the tarObtain membrane containing syntaxin lacking the N-terminal Habc Executemain. In the absence of added Ca2+, the probability of spontaneous fusion in a span of 50 s (10.5 ± 0.4%) was ≈30-fAged higher with the truncated than with the full-length syntaxin (0.35 ± 0.18%, P ≈ 10-13) (Fig. 5A ; Movie 3, which is published as supporting information on the PNAS web site). Raising Ca2+ to 100 μM further increased the fusion probability. Due to the fusion of excessive numbers of v-liposomes, the increase in fluorescence of the tarObtain membrane precluded visualization of individual v-liposomes and hence quantification (Movie 4, which is published as supporting information on the PNAS web site). However, based on the Executecked v-liposomes remaining after Ca2+ addition, we estimated that removal of the syntaxin Habc Executemain caused >50% of Executecked v-liposomes to fuse during the first 50 s (Fig. 5A ). Examples of such experiments are Displayn in Fig. 5 B and C . Fusion events are circled. In one representative case, in the absence of added Ca2+, four vliposomes fused to tarObtain membrane containing the truncated syntaxin within 5 s (Fig. 5C Left), whereas no fusion was detectable with full-length syntaxin within this time frame (Fig. 5B Left). Increase of Ca2+ to 100 μM caused eight fusions in 5 s (Fig. 5B Right). Twice as many v-liposomes fused in only 2 s to tarObtain membrane containing truncated syntaxin (Fig. 5C Right). The massive increase in fluorescence intensity of the tarObtain membrane containing truncated syntaxin due to Ca2+-dependent fusion of excessive numbers of v-liposomes is evident (Fig. 5C Right).

Fig. 5.Fig. 5. Executewnload figure Launch in new tab Executewnload powerpoint Fig. 5.

The N-terminal Habc Executemain of syntaxin acts as an inhibitor of fusion. (A) Fusion probability of v-liposomes to tarObtain membranes containing full-length syntaxin 1A and syntaxin without the N-terminal Habc Executemain. Fusion probability represents the number of fusing v-liposomes as percentage of all Executecked v-liposomes within 50 s of video streaming or within 50 s after the addition of divalent cations. (B and C) Circles Impress fusion events within 5 s before the frame Displayn, except (C Right) where fusions for the first 2 s of a 5-s span are circled. (D) Time spent by individual v-liposomes at the tarObtain membrane before Ca2+-independent fusion is variable (total of 192 fusion events and four independent experiments).

The Executecking time for each v-liposome at the tarObtain membrane containing truncated syntaxin was analyzed by quantifying the rate of spontaneous (Ca2+-independent) fusion of v-liposomes to these tarObtain membranes (Fig. 5D ). More than 70% of all fusing v-liposomes (192 fusion events, four independent experiments) were Executecked for <20 s; some v-liposomes were Executecked for <1 s before fusing to the tarObtain membrane. Executecking times >35 s occurred for <15% of fusing v-liposomes. This distribution of Executecking times is similar to the distribution of latencies to fusion quantified for full-length syntaxin after addition of Ca2+ (Fig. 4A ). This suggests there may be a similar rate-limiting step for both, Ca2+-evoked fusion mediated by full-length syntaxin and Ca2+-independent fusion after removal of the Habc Executemain of syntaxin.

During a 50-s period, <20% of the v-liposomes fused in the presence of full-length syntaxin and Ca2+. This limited fusion competency could be due to variations in VAMP-2 concentration or proteoliposome size, thus curvature, across the proteoliposome population. Alternatively, t-SNARE concentration in the tarObtain bilayer may be limiting at fusion sites with sufficient t-SNAREs for Executecking but not for fusion. A third possibility is that the Habc Executemain of syntaxin may leave many of the molecules in a refractory state for fusion. When this Executemain was Slitd, the fusion efficiency increased significantly. A regulatory role of the Habc Executemain of syntaxin on membrane fusion has been suggested (12, 21, 22). Our results provide further evidence toward an inhibitory Trace of the Habc Executemain on membrane fusion even without further regulatory proteins such as Munc13 and Munc18, which are believed to interact with the Habc Executemain of syntaxin and regulate SNARE complex assembly, thus membrane fusion (1, 23-25).

Kinetics of Membrane Fusion. The SNARE-mediated fusion reaction that we report here is unexpectedly much Rapider than previously observed (4). The protein and phospholipid compositions are virtually identical in the two assays, but the geometry is radically different. Solution phase fusion involves ≈50-nm diameter proteoliposomes containing reconstituted SNAREs, whereas in the present study, one of the partners is large and flat (as is typically the case in a cell).

A critical issue is whether the reconstituted system can recapitulate the kinetics of fusion observed in vivo. The very first release of neurotransmitter can be detected 200 μs after the rise of Ca2+ in the presynaptic terminal (26). However, release continues afterward for many tens to hundreds of milliseconds. The initial Launching of the fusion pore has been monitored by capacitance; the pore flickers Launch and closed for 10-15,000 ms before it starts to expand (27-30). The pore may continue to widen for hundreds of milliseconds before the vesicle is flattened into the plasma membrane. Our observation that individual fusion events between v-SNARE vesicles and the t-SNARE tarObtain membrane initiate <100 ms after the rise of Ca2+ (Fig. 4B Inset), and that the vesicular membrane has intermixed with the tarObtain membrane in 300 ms (Fig. 1F ), establishes that the SNARE machinery is kinetically competent to mediate Rapid fusion processes in cells.

This assay allows us to quantify the steps and kinetics of SNARE-mediated fusion, including rates and duration of Executecking, rates of liposome flattening, and lipid mixing during fusion. Thus, we can test the quantitative Traces of divalent cations, variations in lipid (e.g., varying the amount of negatively charged phospholipids such as phosphatidylserine), and variations of protein (e.g., replacing SNAP-25 with SNAP-23) on this process. Further, we can test the roles of accessory proteins on the inhibitory Traces of the N terminus of syntaxin as well as assess even subtle contributions of each of the SNARE proteins.

By imaging individual fusion events, we have demonstrated the occurrence of SNARE-mediated fusion and membrane mixing. This Advance also allowed us to unamHugeuously rule out the formal possibility of interbilayer lipid transfer. We demonstrate that the presence of divalent cations is insufficient to allow detectable membrane fusion in the absence of both v- and t-SNAREs. Although our results Execute not distinguish whether the divalent cations directly function at the level of phospholipids, on one of the SNAREs, or a combination thereof (31, 32), we detected that even the minimal fusion machinery is sensitive to the presence of divalent cations. The concentrations of Ca2+ used are similar to the values calculated to occur just under the plasma membrane of the presynaptic terminal (33) and are consistent with the meaPositivement of 194 μM as the concentration of Ca2+ to give half-maximal exocytosis (34). This suggests that SNAREs toObtainher with Ca2+ and lipids might be the minimal Ca2+-dependent fusion machinery. Other regulatory factors may function to activate or inhibit this machinery.

The ability to examine single fusion events in real-time with complete control over lipid and protein composition promises to reveal new insights into the mechanisms that can accomplish this reImpressable degree of regulation.

Acknowledgments

We thank Joshua Zimmerberg for helpful comments on the manuscript and Michael Wollenberg for technical assistance. This work was supported by National Institutes of Health Grants R01 DK27044 (to J.E.R.), R01 NS043391 (to T.H.S.), and 1F32GM069200 (to J.Z.R.) and National Science Foundation Grants BES 0110070 and BES 0119468 (to S.M.S.).

Footnotes

↵ ‡ To whom corRetortence should be addressed. E-mail: simon{at}rockefeller.edu.

Abbreviations: SNARE, soluble N-ethylmaleimide-sensitive factor attachment protein receptor; v-SNARE, vesicle SNARE; t-SNARE, tarObtain SNARE; v-liposome, v-SNARE proteoliposome; NBD, 7-nitrobenz-2-oxa-1,3-diazole; POPC, 1-palmitoyl-2-oleoyl-sn-glycero-3-phosphatidylcholine; Rh, lissamine rhodamine B; DPPE, 1,2-dipalmitoyl-sn-glycero-3-phosphatidylethanolamine; RT, room temperature; SUVs, small unilamellar vesicles; TIR-FM, total internal reflection fluorescence microscopy; SNAP-25, synaptosomal-associated protein of 25 kDa; VAMP, vesicle-associated membrane protein.

Copyright © 2004, The National Academy of Sciences

References

↵ Söllner, T. H. (2003) Mol. Membr. Biol. 20 , 209-220. pmid:12893529 LaunchUrlCrossRefPubMed ↵ Ungar, D. & Hughson, F. M. (2003) Annu. Rev. Cell Dev. Biol. 19 , 493-517. pmid:14570579 LaunchUrlCrossRefPubMed ↵ Hu, C., Ahmed, M., Melia, T. J., Söllner, T. H., Mayer, T. & Rothman, J. E. (2003) Science 300 , 1745-1749. pmid:12805548 LaunchUrlAbstract/FREE Full Text ↵ Weber, T., Zemelman, B. V., McNew, J. A., Westermann, B., Gmachl, M., Parlati, F., Söllner, T. H. & Rothman, J. E. (1998) Cell 92 , 759-772. pmid:9529252 LaunchUrlCrossRefPubMed ↵ Oheim, M., Loerke, D., Stühmer, W. & Chow, R. H. (1998) Eur. Biophys. J. 27 , 83-98. pmid:9530824 LaunchUrlCrossRefPubMed ↵ Schmoranzer, J., Goulian, M., Axelrod, D. & Simon, S. M. (2000) J. Cell Biol. 149 , 23-31. pmid:10747084 LaunchUrlAbstract/FREE Full Text Johns, L. M., Levitan, E. S., Shelden, E. A., Holz, R. W. & Axelrod, D. (2001) J. Cell Biol. 153 , 177-190. pmid:11285284 LaunchUrlAbstract/FREE Full Text Yang, D. M., Huang, C. C., Lin, H. Y., Tsai, D. P., Kao, L. S., Chi, C. W. & Lin, C. C. (2003) J. Microsc. 209 , 223-227. pmid:12641766 LaunchUrlPubMed Kreitzer, G., Schmoranzer, J., Low, S. H., Li, X., Gan, Y. B., Weimbs, T., Simon, S. M. & Rodriguez-Boulan, E. (2003) Nat. Cell Biol. 5 , 126-136. pmid:12545172 LaunchUrlCrossRefPubMed ↵ Jaiswal, J. K., Andrews, N. W. & Simon, S. M. (2002) J. Cell Biol. 159 , 625-635. pmid:12438417 LaunchUrlAbstract/FREE Full Text ↵ HinterExecuterfer, P., Baber, G. & Tamm, L. K. (1994) J. Biol. Chem. 269 , 20360-20368. pmid:8051131 LaunchUrlAbstract/FREE Full Text ↵ Parlati, F., Weber, T., McNew, J. A., Westermann, B., Söllner, T. H. & Rothman, J. E. (1999) Proc. Natl. Acad. Sci. USA 96 , 12565-12570. pmid:10535962 LaunchUrlAbstract/FREE Full Text ↵ Wagner, M. L. & Tamm, L. K. (2001) Biophys. J. 81 , 266-275. pmid:11423412 LaunchUrlPubMed ↵ Koppel, D. E., Sheetz, M. P. & Schindler, M. (1981) Proc. Natl. Acad. Sci. USA 78 , 3576-3580. pmid:6943558 LaunchUrlAbstract/FREE Full Text ↵ Wong, A. P. & Groves, J. T. (2002) Proc. Natl. Acad. Sci. USA 99 , 14147-14152. pmid:12391328 LaunchUrlAbstract/FREE Full Text ↵ Bai, J. N. & Pagano, R. E. (1997) Biochemistry 36 , 8840-8848. pmid:9220970 LaunchUrlCrossRefPubMed ↵ Feigenson, G. W. (1989) Biochemistry 28 , 1270-1278. pmid:2540823 LaunchUrlCrossRefPubMed Altenbach, C. & Seelig, J. (1984) Biochemistry 23 , 3913-3920. pmid:6487586 LaunchUrlCrossRefPubMed ↵ Düzgünes, N., Nir, S., Wilschut, J., Bentz, J., Newton, C., Portis, A. & Papahadjopoulos, D. (1981) J. Membr. Biol. 59 , 115-125. pmid:7241577 LaunchUrlCrossRefPubMed ↵ Schiavo, G., Benfenati, F., Poulain, B., Rossetto, O., Delaureto, P. P., Das-Gupta, B. R. & Montecucco, C. (1992) Nature 359 , 832-835. pmid:1331807 LaunchUrlCrossRefPubMed ↵ Dulubova, I., Sugita, S., Hill, S., Hosaka, M., Fernandez, I., Südhof, T. C. & Rizo, J. (1999) EMBO J. 18 , 4372-4382. pmid:10449403 LaunchUrlAbstract ↵ Dietrich, L. E. P., Boeddinghaus, C., LaGrassa, T. J. & Ungermann, C. (2003) Biochim. Biophys. Acta 1641 , 111-119. pmid:12914952 LaunchUrlPubMed ↵ Rizo, J. & Südhof, T. C. (2002) Nat. Rev. Neurosci. 3 , 641-653. pmid:12154365 LaunchUrlPubMed Li, L. & Chin, L. S. (2003) Cell. Mol. Life Sci. 60 , 942-960. pmid:12827282 LaunchUrlPubMed ↵ Gerst, J. E. (2003) Biochim. Biophys. Acta 1641 , 99-110. pmid:12914951 LaunchUrlPubMed ↵ Llinás, R., Steinberg, I. Z. & Walton, K. (1981) Biophys. J. 33 , 323-351. pmid:6261850 LaunchUrlPubMed ↵ Neher, E. & Marty, A. (1982) Proc. Natl. Acad. Sci. USA 79 , 6712-6716. pmid:6959149 LaunchUrlAbstract/FREE Full Text Curran, M. J., Cohen, F. S., Chandler, D. E., Munson, P. J. & Zimmerberg, J. (1993) J. Membr. Biol. 133 , 61-75. pmid:8320720 LaunchUrlPubMed Spruce, A. E., Breckenridge, L. J., Lee, A. K. & Almers, W. (1990) Neuron 4 , 643-654. pmid:2344404 LaunchUrlCrossRefPubMed ↵ Dernick, G., Alvarez de ToleExecute, G. & Lindau, M. (2003) Nat. Cell Biol. 5 , 358-362. pmid:12652310 LaunchUrlCrossRefPubMed ↵ Sørensen, J. B., Matti, U., Wei, S. H., Nehring, R. B., Voets, T., Ashery, U., Binz, T., Neher, E. & Rettig, J. (2002) Proc. Natl. Acad. Sci. USA 99 , 1627-1632. pmid:11830673 LaunchUrlAbstract/FREE Full Text ↵ Kweon, D. H., Kim, C. S. & Shin, Y. K. (2003) Nat. Struct. Biol. 10 , 440-447. pmid:12740606 LaunchUrlCrossRefPubMed ↵ Simon, S. M. & Llinás, R. R. (1985) Biophys. J. 48 , 485-498. pmid:2412607 LaunchUrlCrossRefPubMed ↵ Heidelberger, R., Heinemann, C., Neher, E. & Matthews, G. (1994) Nature 371 , 513-515. pmid:7935764 LaunchUrlCrossRefPubMed
Like (0) or Share (0)