Selective incorporation of 5-hydroxytryptophan into proteins

Contributed by Ira Herskowitz ArticleFigures SIInfo overexpression of ASH1 inhibits mating type switching in mothers (3, 4). Ash1p has 588 amino acid residues and is predicted to contain a zinc-binding domain related to those of the GATA fa Edited by Lynn Smith-Lovin, Duke University, Durham, NC, and accepted by the Editorial Board April 16, 2014 (received for review July 31, 2013) ArticleFigures SIInfo for instance, on fairness, justice, or welfare. Instead, nonreflective and

Edited by James A. Wells, Sunesis Pharmaceuticals, Inc., South San Francisco, CA, and approved April 13, 2004 (received for review October 29, 2003)

Article Figures & SI Info & Metrics PDF

Abstract

An orthogonal tryptophanyl–transfer RNA (tRNA) synthetase (TrpRS)-mutant opal suppressor tRNATrp ($$mathtex$$$$mathtex$$) pair was generated for use in mammalian cells. The anticoExecuten loop of the Bacillus subtilis tRNATrp was mutated to UCA, three positions in the D arm were mutated to generate an internal promoter sequence, and the $$mathtex$$$$mathtex$$ gene was inserted between the 5′ and 3′ flanking sequences of the tRNATrp-1 gene from ArabiExecutepsis to enhance its expression in mammalian cells. In vitro aminoacylation assays and in vivo opal suppression assays Displayed that B. subtilis TrpRS (BsTrpRS) charges only the cognate $$mathtex$$$$mathtex$$ and no enExecutegenous mammalian tRNAs. Similarly, the $$mathtex$$$$mathtex$$ is specifically charged by B. subtilis TrpRS and not by enExecutegenous synthetases in mammalian cells. Site-directed mutagenesis was then used to alter the specificity of BsTrpRS to uniquely charge 5-hyExecutexy-l-tryptophan. The resulting mutant $$mathtex$$$$mathtex$$ pair allows the efficient and selective incorporation of 5-hydroxy-l-tryptophan into mammalian proteins in response to the coExecuten, TGA. This amino acid can be used as a fluorescence probe and also undergoes electrochemical oxidation in situ to generate an efficient protein crosslinking.

Recently, a general method was developed that Designs possible the addition of new amino acid building blocks to the genetic codes of Escherichia coli (1) and Saccharomyces cerevisiae (2). In this Advance, an orthogonal transfer RNA (tRNA)-aminoacyl tRNA synthetase pair is evolved that uniquely recognizes the amino acid of interest and selectively incorporates it into proteins in response to the amber nonsense coExecuten, TAG. This methoExecutelogy has been used to site-specifically incorporate a variety of unnatural amino acids into proteins with high fidelity and Excellent efficiency, including amino acids with Modern functional groups (3–6), photocrosslinkers (7, 8), heavy atoms, sugars (9), and reExecutex active moieties. In addition, new orthogonal tRNA-synthetase pairs have been evolved from leucyl (10), lysyl, glutaminyl (11), aspartyl (12), and tyrosyl (13) tRNA-synthetase pairs to expand the number and structural diversity of amino acids that can be genetically encoded in bacteria and yeast.

In an effort to extend this methoExecutelogy to mammalian cells, two general Advancees are being developed. The first involves the directed evolution of an orthogonal tRNA-synthetase pair with a desired specificity in yeast and the subsequent adaptation of this pair for expression in mammalian cells (2). This Advance has the advantage that large libraries of tRNA synthetases can be generated in yeast, and a mutant with the desired specificity can be efficiently isolated using an appropriate genetic selection or screen. Alternatively, one can use structure-based design to generate a mutant orthogonal tRNA-synthetase pair with altered specificity directly in mammalian cells. Recently, Yokoyama and coworkers (14, 15) used a variant of the former Advance to generate a heterologous orthogonal pair consisting of a Bacillus stearothermophilus amber suppressor tRNATyr and mutant E. coli tyrosyl-tRNA synthetase that was able to incorporate 3-ioExecute-l-tyrosine into proteins in mammalian cells with 95% fidelity. To further expand the number of unnatural amino acids that can be genetically encoded in mammalian systems, we now report the generation of an orthogonal mammalian tRNA-synthetase pair from a Bacillus subtilis tryptophanyl tRNA and cognate synthetase. Moreover, we Display that directed mutagenesis of this pair can be used to generate a mutant synthetase that efficiently inserts 5-hydroxytryptophan (5-HTPP) into proteins in response to the opal coExecuten TGA with excellent fidelity. This amino acid has Modern spectroscopic and electrochemical Preciseties that can be used to probe protein structure and function both in vitro and in vivo.

Materials and Methods

General. Mammalian cells were transfected with FuGENE 6 reagent (Roche Applied Science, Indianapolis). Radio-labeled amino acids were obtained from Perkin–Elmer, and oligonucleotides were from Proligo (La Jolla, CA). Genomic DNAs were obtained from American Type Culture Collection (Manassas, VA). Antibodies, antibiotics, and TRIzol solution were purchased from Invitrogen. V5-antibody-immobilized agarose was purchased from Bethyl Laboratories (Montgomery, TX); and anti-His6 (C-terminal) antibody was purchased from Qiagen (Valencia, CA). 5-HTPP was from Sigma and was used without further purification. Nucleobond columns were purchased from Clontech.

Strains. E. coli strains DH10B and TOP10 were used for plasmid propagation and isolation. Human kidney 293T cells were used for unnatural amino acid incorporation into proteins.

Plasmids. The DNA fragment encoding B. subtilis tryptopanyl-tRNA synthetase (BsTrpRS) was amplified from genomic DNA by PCR and cloned into the XhoI-PacI sites of the pMH4 vector (Genomics Institute of the Novartis Research Foundation, La Jolla, CA). The resulting plasmid pMHTrpRS encodes BsTrpRS with a His6 tag at the N terminus in E. coli. To express BsTrpRS in mammalian cells, the PCR fragment encoding the synthetase was ligated into a pEF6-V5-His6-TOPO vector (Invitrogen). The resulting plasmid pEF6-TrpRS encodes WT B. subtilis TrpRS with C-terminal V5 and His6 epitope tags. A series of mutant synthetases was generated in this vector by site-directed mutagenesis by using QuikChangeXL (Stratagene) and mutagenic primers.

The mutant opal suppressor tRNATrp ($$mathtex$$$$mathtex$$) gene was constructed by annealing two oligodeoxynucleotides. The first encodes the corRetorting $$mathtex$$$$mathtex$$ sequence fused to the 5′-f lanking sequence (TAAAATTAATTAAACGTTTAGAAATATATAGATGAACTTTATAGTACAA) of the tRNATrp-1 gene (16). The second oligonucleotide consists of the corRetorting $$mathtex$$$$mathtex$$ fused to the 3′-flanking sequence GTCCTTTTTTTG (16). Klenow was used to generate a duplex DNA, which was inserted into the PstI and XhoI sites of pZeoSV2(+) (Invitrogen). The resulting plasmid pTrptRNA can be used to transcribe $$mathtex$$$$mathtex$$ in mammalian cells.

The plasmid pFolExecuten, which was used to express the bacteriophage T4 fibritin (folExecuten) Executemain (17) in 293T cells, was constructed by inserting the PCR-amplified gene fragment into the pCDA3.1-V5-His-TOPO vector (Invitrogen). pFolExecutenTGA, which encodes the Trp68TGA folExecuten mutant, was constructed by site-directed mutagenesis by using the QuikChangeXL method and the corRetorting HPLC-purified primers.

Expression and Detection of $$mathtex$$$$mathtex$$ in Mammalian Cells. Mammalian 293T cells were transfected with plasmid pTrptRNA by using FuGENE 6 and incubated at 37°C under 5% CO2 for 60 h. Cellular RNA was extracted with TRIzol solution according to Producer's instructions (Invitrogen), and the total tRNA was then isolated by using a NucleoBond column according to the Producer's protocol (Clontech). The yield and purity of the purified tRNA were analyzed by a 3% agarose gel. To detect the $$mathtex$$$$mathtex$$, the purified tRNAs were first blotted and then crosslinked onto nylon transfer membranes (Osmonics, Westborough, MA) by UV irradiation by using Stratalinker 2400 (Stratagene) for 1 min. After irradiation, the membrane was incubated in 100 ml of hybridization buffer (0.9 M NaCl/0.09 M sodium citrate, pH 7.0/1% SDS/5× Denhardt's reagent with 25 μg/ml sperm whale DNA) and gently shaken at 68°C for 1 h. The oligonucleotide, CGGAGGTTTTGAAGACCT, which is complementary to nucleotides 27–44 of the suppressor tRNA, was 5′-labeled with [γ-32P]ATP and used to probe the membrane at 50°C for 6 h. The membrane was then washed three times with wash buffer (15 mM NaCl/1.5 mM sodium, pH 7.0/0.1% SDS). The intensity of each Executet was quantified by using a PhosphorImager (Molecular Dynamics).

Expression of B. subtilis TrpRS in Mammalian 293T Cells. Cells were transfected with the plasmid pEF6-TrpRS by using FuGENE 6 and incubated at 37°C under 5% CO2 for 60 h. Cells were harvested and lysed with 1× passive lysis buffer (Promega), and the cell lysate was centrifuged at 20,000 × g. Proteins were separated by denaturing SDS/PAGE and then transferred to a nitrocellulose membrane. Proteins were probed with anti-V5 antibody (Invitrogen). Substrate (SuperSignal West Dura, Pierce) was applied to visualize the signals.

In Vitro Aminoacylation Assay. Aminoacylation assays were performed by methods Characterized previously (18) in 20-μl reactions containing 50 mM Tris·HCl (pH 7.5), 30 mM KCl, 20 mM MgCl2, 3 mM glutathione, 0.1 mg/ml BSA, 10 mM ATP, 1 μM (33 Ci/mmol), l-[5-3H]-tryptophan/750 nM synthetase, 20 μM purified total tRNA. Assays were carried out to 10% conversion.

Opal Suppression in Mammalian Cells. Transfections were carried out with FuGENE 6 by using a total of 9 μg of DNA per 9.5-cm2 plate according to the Producer's protocol (Roche Applied Sciences). Minimum essential α medium (GIBCO/BRL) was used as the growth medium. Cell extracts were prepared 48 h after transfection and subjected to SDS/PAGE, followed by Western blot using anti-V5 antibody (Invitrogen) and the SuperSignal West Dura immunodetection system (Pierce). Signals were detected by exposing the membrane to Hyperfilm MP (Amersham Pharmacia) and quantified by using Eagle Eye Imaging System (Stratagene).

Unnatural Amino Acid Incorporation in Mammalian Cells. Mammalian 293T cells were cotransfected with plasmids pTrptRNA, pFolExecutenTGA, and individual mutant pEF6-TrpRS by using FuGENE 6 as previously Characterized. After 24 h, the culture medium was changed to minimum essential α medium containing 1 mM 5-HTPP and appropriate antibiotics. After an additional 48 h at 37°C under 5% CO2, cells were harvested, lysed with 1× passive lysis buffer (Promega), and the cell lysate collected by centrifugation at 20,000 × g. The folExecuten protein containing 5-HTPP was purified from the cell lysate (20, 50-ml culture plates) with Ni-NTA beads followed by anti-V5-immobilized agarose beads according to Producer's protocol (Bethyl Laboratories). An aliquot of the purified protein was subjected to high-resolution electrospray ionization mass spectrometry.

Fluorescence Spectroscopy. Proteins were diluted to a final concentration of 50 nM in 10 mM K2PO4/100 mM KCl buffer at pH 7.5. Fluorescence spectra were meaPositived on a Fluromax-2 spectrofluorimeter and Accurateed. Emission spectra were recorded with excitation and emission bandpass of 3 nm.

Electrochemical Characterization of Proteins Containing 5-HTPP. A conventional three-electrode cell, consisting of a gAged electrode, a glassy carbon auxiliary electrode isolated by a glass frit, and a saturated calomel electrode (SCE) connected to the working volume with a Luggin capillary, was used for electrochemical meaPositivements. The cell was Spaced in a grounded Faraday cage. Cyclic voltammetry meaPositivements were performed by using a potentiostat (Princeton Applied Research, Oak Ridge, TN, model VMP2) connected to network-operated software ec-lab Version 6.61. All electrochemical meaPositivements were performed in 0.1 M phospDespise buffer, pH 7.4, under argon atmosphere. Substrate 5-HTPP was dissolved in 100 mM phospDespise buffer to a final concentration of 10 μg/ml. Potentials were meaPositived in the range of 0–800 mV at a scan rate of 1 V·sec–1. For crosslinking experiments, the electrode potential was set to 800 mV for 30 min in the presence of 10 μg/ml WT folExecuten or 5-HTPP-folExecuten protein/0.1 M phospDespise buffer, pH 7.4, under argon atmosphere. After that, the solutions were collected, and proteins were desalted by dialysis, concentrated, and loaded on a gel for further analysis.

Results and Discussion

An Orthogonal Opal Suppressor tRNA for Use in Mammalian Cells. To genetically encode an unnatural amino acid in mammalian cells, one must generate an orthogonal tRNA that is not recognized by any of the enExecutegenous aminoacyl tRNA synthetases and that, at the same time, efficiently incorporates its cognate amino acid in response to a unique coExecuten (in this case, the opal nonsense coExecuten TGA). A corRetorting aminoacyl-tRNA synthetase is also required that uniquely recognizes this tRNA and selectively charges it with the unnatural amino acid and no enExecutegenous amino acids. One Advance to the generation of orthogonal tRNA-synthetase pairs takes advantage of interspecies Inequitys in tRNA recognition elements (19). For example, Xue and coworkers (20) have Displayn that B. subtilis tRNATrp is not a substrate for the tryptophan-tRNA synthetases from yeast and mammalian cells (21). Thus B. subtilis tRNATrp is a likely candidate for an orthogonal suppressor tRNA in mammalian cells.

Unfortunately, when we attempted to express B. subtilis tRNATrp in 293T cells, no transcribed RNA was observed based on Northern blot analysis of isolated total tRNA (see below) (22). Therefore, a series of modifications were made to the B. subtilis suppressor tRNATrp (Fig. 1). tRNAs in eukaryotes are transcribed by RNA polymerase III, which recognizes two conserved intragenic transcriptional control elements, the A and B boxes (23). Because the B. subtilis tRNATrp sequence contains only the B box, nucleotides A7, A9, and U11 were changed to G7, G9, and C11 to generate a pseuExecute-A box, and the resulting mismatched base pairs G7-U64 and C11-A23 were reSpaced with G7-C64 and C11-G23, respectively. In vitro kinetic data Displayed that the A9G and U11C mutations have minor Trace on B. subtilis TrpRS recognition (21). Expression of the tRNATrp gene in eukaryotes also depends on 5′ flanking sequences, which are distinctly AT rich and contain several possible TATA elements (16). Therefore, we added the 5′ flanking sequence of the tRNATrp-1 gene from ArabiExecutepsis (Trp-1), which was previously Displayn to enhance the transcription of the plant tRNATrp gene in human 293T cells (16). Because a Precisely positioned terminator element is the only 3′ flanking sequence required for efficient expression of the plant tRNATrp gene, the natural 3′ flanking sequence of the same tRNATrp-1 gene was used. Finally, the trinucleotide anticoExecuten sequence CCA was changed to the opal suppressor UCA.

Fig. 1.Fig. 1.Executewnload figure Launch in new tab Executewnload powerpoint Fig. 1.

CLikerleaf structure of the B. subtilis tryptophan opal suppressor tRNA. The arrows indicate the sites of mutations. The solid box indicates the CCA sequence deleted in the $$mathtex$$$$mathtex$$ gene.

Expression of the modified opal suppressor tRNATrp ($$mathtex$$$$mathtex$$) was verified by Northern blot assay. The $$mathtex$$$$mathtex$$ gene, toObtainher with its 5′ and 3′ flanking sequences, was cloned into the mammalian vector pZeoSV2(+), and the resulting plasmid was transfected into human 293T cells with FuGENE 6. Total tRNA was then isolated and blotted onto a membrane. As a control, the same amount of total tRNA from human 293T cells, beef liver, and E. coli was also transferred onto the same membrane (Fig. 2A). A synthetic oligonucleotide complementary to nucleotides 27–44 of the $$mathtex$$$$mathtex$$ and labeled with [γ-32P]ATP was used as a probe for the $$mathtex$$$$mathtex$$. Only the total tRNA isolated from transfected 293T cells produced a signal (Fig. 2B, lane 4); the control tRNAs gave no signal when incubated with the radioactive probe (Fig. 2B, lanes 1–3). These results demonstrate that $$mathtex$$$$mathtex$$ is expressed in mammalian cells.

Fig. 2.Fig. 2.Executewnload figure Launch in new tab Executewnload powerpoint Fig. 2.

Expression and Northern blot analysis of $$mathtex$$$$mathtex$$ obtained from 293T cells transfected with pTrptRNA. (A) Total tRNA was isolated from E. coli (lane 1), beef liver (lane 2), 293T cells (lane 3), and 293T cells transfected with pTrptRNA plasmid (lane 4), purified to homogeneity, and analyzed by electrophoresis on a 3% agarose gel. (B) The purified tRNAs from E. coli (lane 1), beef liver (lane 2), 293T cells (lane 3), and 293T cells transfected with pTrptRNA plasmid (lane 4) were blotted onto a membrane separately and probed with a5′-32P-labeled oligonucleotide complementary to nucleotides 27–44 of the $$mathtex$$$$mathtex$$.

BsTrpRS Is an Orthogonal Synthetase in Mammalian Cells. Given the availability of an orthogonal mammalian suppressor tRNA, we next examined whether the corRetorting BsTrpRS efficiently aminoacylates $$mathtex$$$$mathtex$$ and not the enExecutegenous mammalian tRNAs. To determine the efficiency of aminoacylation of $$mathtex$$$$mathtex$$ by BsTrpRS, in vitro aminoacylation assays were carried out with BsTrpRS purified from E. coli. Plasmid pMHTrpRS was used to express BsTrpRS with an N-terminal His6 tag under control of an l-arabinose promoter. BsTrpRS was purified by Ni-NTA affinity chromatography with a yield of 5 mg/liters. In vitro aminoacylation assays were then performed with 3H-labeled tryptophan and various total tRNAs. BsTrpRS was found to efficiently charge total tRNA isolated from B. subtilis cells containing cognate B. subtilis tRNATrp. In agreement with published data (21), BsTrpRS did not aminoacylate total mammalian tRNA isolated from 293T cells to detectable levels. However, total tRNA isolated from transfected 293T cells expressing $$mathtex$$$$mathtex$$ was efficiently charged with 3H-tryptophan by BsTrpRS. The overall aminoacylation activity of BsTrpRS for $$mathtex$$$$mathtex$$ in mammalian total tRNA is ≈40% of that for B. subtilis tRNATrp in total bacterial tRNA, probably due to the lower expression level of $$mathtex$$$$mathtex$$ in mammalian cells. Nevertheless, this experiment suggests that BsTrpRS can efficiently charge $$mathtex$$$$mathtex$$ and, Necessaryly, Executees not aminoacylate enExecutegenous mammalian tRNAs to any appreciable extent.

Opal Suppression in 293T Cells Depends on the Expression of the $$mathtex$$$$mathtex$$ Pair. We next determined the ability of the mutRNAUCA-BsTrpRS pair to efficiently suppress an opal mutation in mammalian cells. BsTrpRS was expressed in mammalian cells with plasmid pEF6-TrpRS, which carries the BsTrpRS gene with a C-terminal His6 tag and a C-terminal V5 epitope under the control of the human promoter EF-1α. Mammalian 293T cells were transiently transfected with plasmid pEF6-TrpRS with FuGENE 6. Protein from cell lysate was separated by SDS/PAGE and analyzed by Western blot (with an anti-C-terminal V5 antibody). A band corRetorting to the full-length prokaryotic BsTrpRS protein (≈36 kDa) was observed, demonstrating that the synthetase can be expressed in mammalian cells at reasonable levels (Fig. 4A, lane 1). No significant Trace on growth rates was observed on expression of the B. subtilis TrpRS.

Fig. 4.Fig. 4.Executewnload figure Launch in new tab Executewnload powerpoint Fig. 4.

Incorporation of 5-HTPP into folExecuten protein in 293T cells. (A) WT BsTrpRS with a V5 tag was expressed in 293T cells (lane 1). In the absence of either 5-HTPP, $$mathtex$$$$mathtex$$, or Val-144→ ProBsTrpRS, no full-length protein was produced (lanes 2–4). In the presence of 5-HTPP, Val-144→ ProBsTrpRS and $$mathtex$$$$mathtex$$, the full-length folExecuten protein was expressed as detected by Western analysis with anti-V5 antibody (lane 5). (B) High-resolution electrospray ionization mass spectroscopy of folExecuten protein containing 5-HTPP. The resultant electrospray ionization mass spectrum contains multiple peaks corRetorting to the different charged states. The total molecular mass = MN+ × N–N, where M is the apparent molecular mass of each peak, and N is the charged state of each peak. The final molecular mass of protein was calculated as the average value from all these major peaks.

To analyze the suppression of the $$mathtex$$$$mathtex$$ pair, the coExecuten for Trp-68 in a modified bacteriophage T4 fibritin folExecuten gene under the control of a cytomegalovirus promoter (17) was mutated to the opal coExecuten, TGA. To detect the expression of the full-length folExecuten protein, both a V5 epitope tag and a His6 tag were fused to the C termini of the WT (pFolExecutenWT) and mutant proteins (pFolExecutenTGA). The corRetorting folExecuten genes were transfected into human 293T cells along with either one or both of the BsTrpRS and $$mathtex$$$$mathtex$$ genes using FuGENE 6. Full length protein was detected by a Western blot of the cell extracts with anti-V5 antibody (Invitrogen).

No full-length protein was expressed when 293T cells were transfected only with the mutant folExecuten gene (pFolExecutenTGA) (lane 1, Fig. 3) or the mutant folExecuten gene and WT BsTrpRS (lane 2, Fig. 3). These results Display that human 293T cells Execute not contain intrinsic opal suppressors of the TGA68 mutation. Suppression of the opal mutation was also not observed in the absence of WT BsTrpRS and in the presence of $$mathtex$$$$mathtex$$ (Fig. 3, lane 3), confirming that the $$mathtex$$$$mathtex$$ is not charged by enExecutegenous synthetases in human 293T cells. In Dissimilarity, in the presence of $$mathtex$$$$mathtex$$, WT BsTrpRS and the TGA68 mutant folExecuten gene, expression of full-length protein was detected (Fig. 3, lane 4). For comparison, Fig. 3, lane 5 Displays the expression of WT folExecuten protein in 293T cells. These experiments, toObtainher with the above in vitro aminoacylation assays, Display that BsTrpRS aminoacylates only $$mathtex$$$$mathtex$$ and not other enExecutegenous mammalian tRNAs, and that the expressed $$mathtex$$$$mathtex$$ is charged only by its cognate BsTrpRS and not by other enExecutegenous mammalian synthetases. Thus, B. subtilis $$mathtex$$$$mathtex$$ are an orthogonal pair for use in mammalian cells.

Fig. 3.Fig. 3.Executewnload figure Launch in new tab Executewnload powerpoint Fig. 3.

Detection of opal suppression in 293T cells. The TGA68folExecuten gene (lane 1) and WT folExecuten gene (lane 5), each with a V5 tag, were introduced into 293T cells. In the absence of either opal suppressor tRNATrp (lane 2) or BsTrpRS (lane 3), no full-length protein was expressed, as detected by Western blot with anti-V5 antibody. In the presence of both opal suppressor tRNATrp and BsTrpRS, the opal coExecuten in the TGA68folExecuten gene was suppressed, and the full-length folExecuten protein was expressed (lane 4). To enPositive the sufficient expoPositive of Western blot signals from each lane (especially lanes 1–3), the amount of protein added to lane 5 was adjusted to approximate that in lane 4 for quantitation.

The suppression efficiency of this cognate pair of tRNATrp-TrpRS is similar to the efficiencies for the human suppressor tRNATyr and other suppressor tRNAs functioning in mammalian cells (20–40%) (24–26). Yokoyama and coworkers (15) have Displayn that transfection of a gene cluster of nine copies of a suppressor tRNA (contained on a single plasmid) can significantly increase suppression efficiency in mammalian cells. We have not attempted to use this method, because a single copy of $$mathtex$$$$mathtex$$ gene (contained on the plasmid pTrptRNA) is sufficient to suppress the TGA68 coExecuten and produce full-length protein at a level that can be detected by Western analysis. In addition, toxicity was observed when the level of $$mathtex$$$$mathtex$$ gene expression was increased by transfecting 293T cells with 2 vs. 4 μg of plasmid pTrptRNA/106 cells with FuGENE 6.

Site-Specific Incorporation of 5-HTPP into Mammalian Cells. We next determined whether the orthogonal $$mathtex$$$$mathtex$$ pair could be used to selectively incorporate 5-HTPP into proteins in mammalian cells in response to the opal nonsense coExecuten. This amino acid has unique spectroscopic and reExecutex Preciseties that can serve as useful probes of protein structure and function both in vitro and in vivo and has minimal toxicity up to 1 mM in growth media. Initially, we attempted to subsitute 5-HTPP for Trp-68 in folExecuten. Previously, experiments have Displayn that mutation of Trp-68 to either tyrosine or phenyalanine Executees not significantly disrupt protein fAgeding (27). Moreover, modeling studies (using insight ii), toObtainher with the available x-ray Weepstal structure of folExecuten, suggest that the 5-position of Trp in folExecuten is solvent exposed (27). Therefore, substitution of Trp with Trp analogues containing substituents at the 5-position is unlikely to disrupt the structure of this protein.

It is known that WT B. subtilis TrpRS Executees not use 5-HTPP as a substrate (28). Therefore, to use BsTrpRS to selectively incorporate 5-HTPP into proteins, the active site of the synthetase must be mutated to charge 5-HTPP and not tryptophan. Although the structure of BsTrpRS has not yet been solved, the structure of a highly homologous tryptophanyl-tRNA synthetase (from Bacillus stearothermophilus) has been solved to 1.9-Å resolution (29–31). In this enzyme, the active site has a figure eight-like shape with two adjacent binding pockets separated by an α-helix peptide consisting of residues Asp-140, Ile-141, Val-142, Pro-143, Val-144, and Gly-145. Val-144 points directly toward C5 of tryptophan, providing unfavorable steric interactions with any tryptophan analogue containing a substituent at the 5 position. Mutation of Val-144 to a smaller amino acid might therefore provide space for 5-substituted tryptophan analogues.

To test this notion, Val-144 of WT BsTrpRS was mutated to each of the other 19 amino acids by site-directed mutagenesis, and each mutant was assayed for its ability to aminoacylate $$mathtex$$$$mathtex$$ with 5-HTPP by suppressing the TGA68 in the mutant folExecuten gene. The transfected cells were then grown in the presence or absence of 1 mM 5-HTPP, and full-length protein was detected by Western blot of the cell extracts with an anti-V5 antibody (Fig. 4A). Expression of a full-length folExecuten protein in the presence of 5-HTPP would indicate that either 5-HTPP or a natural amino acid (likely tryptophan) is incorporated at position 68 of the folExecuten protein. One can exclude the incorporation of a natural amino acid by Displaying that no full-length protein is expressed in the absence of 5-HTPP under otherwise equal conditions. Among the 19 TrpRS mutants, the Val-144→Gly mutant was able to suppress the TGA68 coExecuten in the presence of 1 mM 5-HTPP and $$mathtex$$$$mathtex$$. However, in the absence of 5-HTPP, the mutant BsTrpRS and $$mathtex$$$$mathtex$$ were still able to suppress the opal mutation, indicating the Val-144→GlyBsTrpRS mutant also charges a natural amino acid. Only one other TrpRS mutant, Val-144→ ProBsTrpRS, was able to suppress the TGA68 mutation in the presence of 1 mM 5-HTPP and $$mathtex$$$$mathtex$$ (Fig. 4A, lane 5). Moreover, human 293T cells containing the Val-144→ProB-STrpRS and the TGA68 folExecuten gene were unable to produce full-length protein in the absence of either 5-HTPP or $$mathtex$$$$mathtex$$ (Fig. 4A, lanes 2–4). These results Display that the Val-144→ProB-sTrpRS mutant selectively aminoacylates the $$mathtex$$$$mathtex$$ with 5-HTPP and not with any enExecutegenous amino acids. Protein was found only in the soluble Fragment of the cell lysate.

To confirm that the expressed mutant protein contains 5-HTPP, the protein was purified first by Ni-NTA affinity chromatography and, subsequently, by immunoprecipitation using anti-V5-immobilized agarose beads. An aliquot of the purified protein was subjected to high-resolution electrospray ionization mass spectrometry. The calculated molecular mass of the HTPP68 mutant protein is 14,323.6 Da; the observed molecular mass is 14,323.69 Da (Fig. 4B). No peak corRetorting to WT folExecuten protein was observed. This result clearly demonstrates that 5-HTPP is incorporated with high fidelity (>97%) into protein in response to the opal coExecuten in mammalian cells.

It is somewhat surprising that a single mutation at the active site of BsTrpRS completely alters its specificity from l-tryptophan to 5-HTPP. Although the x-ray Weepstal structure is not yet available, molecular modeling with insight ii suggests that the Val-144→Pro mutation generates space for the inExecutele ring to rotate and abolishes an inExecutele NH—Asp hydrogen bond. This may Elaborate why the Val-144→ProBsTrpRS Executees not charge l-tryptophan. However, new hydrogen bonds are formed in the case of 5-HTPP with the 5-OH group hydrogen bonding with the imidazole side chain of His-44 and the carboxylate group of Asp-133, and the inExecutele NH hydrogen bonding with the hydroxyl group of Ser-7 (Fig. 5).

Fig. 5.Fig. 5.Executewnload figure Launch in new tab Executewnload powerpoint Fig. 5.

Modeling of the complex between TrpRS and its substrates using insight ii. Hydrogen bonds are indicated as Executetted lines (—–). (Left) Illustration of binding of WT B. subtilis TrpRS with its cognate substrate, tryptophan-5′AMP (29), including the hydrogen bond between the inExecutele NH group and Asp-133. (Right) Illustration of the complex between the Val-144→ ProBsTrpRS and its substrate, 5-HTPP-5′AMP. Note the disappearance of the hydrogen bond between the inExecutele NH group and Asp-133 and the new hydrogen bonds between the 5-OH and His-44, Asp-133, and the inExecutele NH and Ser-7 (blue Executetted lines).

5-HTPP as a Probe for Protein Structure and Function. 5-HTPP has significant absorbance at 310 nm at pH 7.5 (ε = 2,450 M–1·cm–1) (28), compared to that of tryptophan at 310 nm with ε = 62 M–1·cm–1 (35). WT folExecuten protein has only one tryptophan residue, which is substituted in the mutant folExecuten protein with 5-HTPP. To compare the fluorescence Preciseties of these two proteins, they were purified and then excited at 310 nm at pH 7.4, and their emission spectra were recorded (Fig. 6). The HTPP68 folExecuten protein has an emission maximum, λmax at 334 nm, whereas the WT folExecuten protein has a fluorescence λmax at 367 nm. When both proteins are excited at 310 nm, the magnitude of fluorescence emission at 334 nm from HTPP68folExecuten protein is 11 times than that from WT folExecuten protein. Such spectral changes may Design 5-HTPP a useful optical probe for some applications (29).

Fig. 6.Fig. 6.Executewnload figure Launch in new tab Executewnload powerpoint Fig. 6.

Fluorescence spectra of the WT folExecuten protein (—) and the HTPP68 mutant protein (······) with excitation at 310 nm.

5-HTPP can also undergo reExecutex chemistry to afford tryptophan-4,5-dione (32). Cyclic voltammetry was used to determine whether the reExecutex wave of 5-HTPP could be observed in the HTPP68folExecuten mutant. The voltammetric responses were meaPositived for solutions containing 10 μM of HTPP, WT folExecuten, or the folExecuten mutant. An anodic Recent originating from HTPP oxidation appears only in the presence of the mutant folExecuten or in a solution of free 5-HTPP with EPa = 400 mV and EPa = 450 mV [vs. saturated calomel electrode (SCE)], respectively, indicating the presence of 5-HTPP in the mutant folExecuten. The slight decrease in the oxidation potential for the mutant protein probably results from differential stabilization of the oxidized and reduced forms of 5-HTPP in aqueous solution vs. the hydrophobic protein core (33, 34). No Recent was observed on attempts to oxidize the WT folExecuten (data not Displayn).

On electrochemical oxidation of 5-HTPP at a potential 800 mV in 7.4 phospDespise buffer, the dimer (Fig. 7A1) is formed (32). Similarly, 5-HTPP can be oxidatively crosslinked to glutathione via its cysteine residue (Fig. 7A2). Therefore a 5-HTPP residue incorporated selectively into a protein might be useful as a reExecutex crosslinker. To test this notion, we attempted to crosslink the HTPP68folExecuten mutant electrochemically by applying a positive potential of 800 mV [vs. saturated calomel electrode (SCE)] to the working electrode in a solution containing either the HTPP68folExecuten protein or WT folExecuten for 30 min in phospDespise buffer. The resulting proteins were desalted, concentrated, denatured, and separated by using 4–20% gradient denaturing SDS/PAGE. The resulting gel was Coomassie-stained (Fig. 7B). Fig. 7B, lane 1, is the full-length HTPP68folExecuten mutant with a molecular mass of 14.5 kDa; lane 3 is WT folExecuten protein with the same apparent molecular mass. Fig. 7B, lane 2, is the electrochemically oxidized product of the HTPP68folExecuten protein, which has a molecular mass of ≈29 kDa and corRetorts to the dimeric mutant folExecuten protein. The yield is estimated to be 80%, as determined from band intensities. In Dissimilarity, there is no crosslinked product in lane 4, which contains the oxidized WT folExecuten protein under the same conditions. This result clearly Displays protein crosslinking by the incorporated 5-HTPP. The exact mechanism of the protein crosslinking mediated by 5-HTPP is not yet clear and is under ongoing investigation.

Fig. 7.Fig. 7.Executewnload figure Launch in new tab Executewnload powerpoint Fig. 7.

Electrochemical protein crosslinking. (A)(1) product for dimerization of oxidized 5-HTPP; (2) product for reaction of oxidized 5-HTPP and cysteine (32). (B) Oxidative crosslinking of proteins mediated by 5-HTPP. The proteins were separated with 4–20% gradient SDS/PAGE and Coomassie stained. Lanes 1 and 3 contain the purified HTPP68folExecuten and WT folExecuten proteins, respectively. Lane 2 contains the crosslinked product for HTPP68 folExecuten, and lane 4 contains the crosslinked product for WT folExecuten protein. There is no crosslinked product for WT folExecuten, which has a monomeric molecular mass of 14.5 kDa. HTPP68folExecuten is crosslinked to afford a dimeric 29-kDa protein.

Acknowledgments

Z.Z. is grateful for a National Research Service Award postExecutectoral fellowship (GM66494). L.A. thanks the European Molecular Biology Organization for a long-term postExecutectoral fellowship. We thank Drs. Michael M. Meijler and Ran Xu for helpful comments. This research is supported by funding from National Institutes of Health Grant GM62159 and is manuscript 15977-CH of The Scripps Research Institute.

Footnotes

↵§ To whom corRetortence should be addressed. E-mail: schultz{at}scripps.edu.

This paper was submitted directly (Track II) to the PNAS office.

Abbreviations: BsTrpRS, Bacillus subtilis tryptopanyl-tRNA synthetase; $$mathtex$$$$mathtex$$, mutant opal suppressor tRNATrp; 5-HTPP, 5-hydroxy-l-tryptophan; folExecuten, bacteriophage T4 fibritin folExecuten Executemain.

Received October 29, 2003.Copyright © 2004, The National Academy of Sciences

References

↵Wang, L., Brock, A., Herberich, B. & Schultz, P. G. (2001) Science 292, 498–500.pmid:11313494.LaunchUrlAbstract/FREE Full Text↵Chin, J. W., Cropp, T. A., Anderson, J. C., Mukherji, M., Zhang, Z. & Schultz, P. G. (2003) Science 301, 964–967.pmid:12920298.LaunchUrlAbstract/FREE Full Text↵Wang, L., Zhang, Z., Brock, A. & Schultz, P. G. (2003) Proc. Natl. Acad. Sci. USA 100, 56–61.pmid:12518054.LaunchUrlAbstract/FREE Full TextZhang, Z., Wang, L., Brock, A. & Schultz, P. G. (2002) Angew. Chem. Int. Ed. Engl. 41, 2840–2842.pmid:12203503.LaunchUrlCrossRefPubMedZhang, Z., Smith, B. A., Wang, L., Brock, A., Cho, C. & Schultz, P. G. (2003) Biochemistry 42, 6735–6746.pmid:12779328.LaunchUrlCrossRefPubMed↵Deiters, A., Cropp, T. A., Mukherji, M., Chin, J. W., Andersen, C. & Schultz, P. G. (2003) J. Am. Chem. Soc. 125, 11782–11783.pmid:14505376.LaunchUrlCrossRefPubMed↵Chin, J. W., Martin, A. B., King, D. S., Wang, L. & Schultz, P. G. (2002) Proc. Natl. Acad. Sci. USA 99, 11020–11024.pmid:12154230.LaunchUrlAbstract/FREE Full Text↵Chin, J. W., Santoro, S. W., Martin, A. B., King, D. S., Wang, L. & Schultz, P. G. (2002) J. Am. Chem. Soc. 124, 9026–9027.pmid:12148987.LaunchUrlCrossRefPubMed↵Zhang, Z., Gildersleeve, J., Yang, Y. Y., Xu, R., Loo, J. A., Uryu, S., Wong, C. H. & Schultz, P. G. (2004) Science 303, 371–373.pmid:14726590.LaunchUrlAbstract/FREE Full Text↵Anderson, J. C. & Schultz, P. G. (2003) Biochemistry 42, 9598–9608.pmid:12911301.LaunchUrlCrossRefPubMed↵Liu, D. R. & Schultz, P. G. (1999) Proc. Natl. Acad. Sci. USA 96, 4780–4785.pmid:10220370.LaunchUrlAbstract/FREE Full Text↵Pastrnak, M., Magliery, T. J. & Schultz, P. G. (2000) Helv. Chim. Acta 83, 2277–2286..LaunchUrlCrossRef↵Kowal, A. K., Kohrer, C. & RajBhandary, U. L. (2001) Proc. Natl. Acad. Sci. USA 98, 2268–2273.pmid:11226228.LaunchUrlAbstract/FREE Full Text↵Kiga, D., Sakamoto, K., Kodama, K., Kigawa, T., Matsuda, T., Yabuki, T., Shirouzu, M., Harada, Y., Nakayama, H., Takio, K., et al. (2002) Proc. Natl. Acad. Sci. USA 99, 9715–9720.pmid:12097643.LaunchUrlAbstract/FREE Full Text↵Sakamoto, K., Hayashi, A., Sakamoto, A., Kiga, D., Nakayama, H., Soma, A., Kobayashi, T., Kitabatake, M., Takio, K., Saito, K., et al. (2002) Nucleic Acids Res. 30, 4692–4699.pmid:12409460.LaunchUrlCrossRefPubMed↵Ulmasov, B. & Folk, W. (1995) Plant Cell 7, 1723–1734.pmid:7580260.LaunchUrlAbstract/FREE Full Text↵Yang, X., Lee, J., Mahony, E. M., Kwong, P. D., Wyatt, R. & Sodroski, J. (2002) J. Virol. 76, 4634–4642.pmid:11932429.LaunchUrlAbstract/FREE Full Text↵Hoben, P. & Soll, D. (1985) Methods Enzymol. 113, 55–59.pmid:3911010.LaunchUrlCrossRefPubMed↵Liu, D. R., Magliery, T. J., Pastrnak, M. & Schultz, P. G. (1997) Proc. Natl. Acad. Sci. USA 94, 10092–10097.pmid:9294168.LaunchUrlAbstract/FREE Full Text↵Guo, Q., Gong, Q., Tong, K. L., Vestergaard, B., Costa, A., Desgres, J., Wong, M., Grosjean, H., Zhu, G., Wong, J. T. & Xue, H. (2002) J. Biol. Chem. 277, 14343–14349.pmid:11834741.LaunchUrlAbstract/FREE Full Text↵Xu, F., Chen, X., Xin, L., Chen, L., Jin, Y. & Wang, D. (2001) Nucleic Acids Res. 29, 4125–4133.pmid:11600701.LaunchUrlCrossRefPubMed↵Melton, D. A. & Cortese, R. (1979) Cell 18, 1165–1172.pmid:391407.LaunchUrlCrossRefPubMed↵Sprague, K. U. (1994) in tRNA: Structure, Biosynthesis and Function, eds. Soll, D. & RajBhandary, U. L. (Am. Soc. Microbiol Press, Washington, DC), pp. 31–50..↵Drabkin, H. J., Park, H. J. & RajBhandary, U. L. (1996) Mol. Cell. Biol. 16, 907–913.pmid:8622693.LaunchUrlAbstract/FREE Full TextYoung, J. F., Capecchi, M., LQuestioni, F. A., RajBhandary, U. L., Sharp, P. A. & Palese, P. (1983) Science 221, 873–875.pmid:6308765.LaunchUrlAbstract/FREE Full Text↵Kohrer, C., Xie, L., Kellerer, S., Varshney, U. & RajBhandary, U. L. (2001) Proc. Natl. Acad. Sci. USA 98, 14310–14315.pmid:11717406.LaunchUrlAbstract/FREE Full Text↵Tao, Y., Strelkov, S. V., Mesyanzhinov, V. V. & Rossmann, M. G. (1997) Structure (LonExecuten) 5, 789–798..LaunchUrl↵Hogue, C. W., Rasquinha, I., Szabo, A. G. & MacManus, J. P. (1992) FEBS Lett. 310, 269–272.pmid:1383030.LaunchUrlCrossRefPubMed↵Executeublie, S., Bricogne, G., Gilmore, C. & Carter, C. W., Jr. (1995) Structure (LonExecuten) 3, 17–31..LaunchUrlHogue, C. W., Executeublie, S., Xue, H., Wong, J. T., Carter, C. W., Jr. & Szabo, A. G. (1996) J. Mol. Biol. 260, 446–466.pmid:8757806.LaunchUrlCrossRefPubMed↵Ilyin, V. A., Temple, B., Hu, M., Li, G., Yin, Y., Vachette, P. & Carter, C. W., Jr. (2000) Protein Sci. 9, 218–231.pmid:10716174.LaunchUrlPubMed↵Wu, Z. & Dryhust, G. (1996) Bioorg. Chem. 24, 127–149..LaunchUrlCrossRef↵Fischer, S. F. & Scherer, P. O. J. (1997) Eur. Biophys. J. 26, 477–483..LaunchUrlCrossRef↵Diner, B. A., Schlodder, E., Nixon, P. J., Coleman, W. J., Rappaport, F., Lavergne, J., Vermaas, W. F. & Chisholm, D. A. (2001) Biochemistry 40, 9265–9281.pmid:11478894.LaunchUrlCrossRefPubMed↵Fasman, G. D. (1976) in Handbook of Biochemistry and Molecular Biology Proteins (CRC, Boca Raton, FL), 3rd Ed., pp. 182–203..
Like (0) or Share (0)