Mpl Baltimore: A thrombopoietin receptor polymorphism associ

Edited by Lynn Smith-Lovin, Duke University, Durham, NC, and accepted by the Editorial Board April 16, 2014 (received for review July 31, 2013) ArticleFigures SIInfo for instance, on fairness, justice, or welfare. Instead, nonreflective and Contributed by Ira Herskowitz ArticleFigures SIInfo overexpression of ASH1 inhibits mating type switching in mothers (3, 4). Ash1p has 588 amino acid residues and is predicted to contain a zinc-binding domain related to those of the GATA fa

Communicated by Victor A. McKusick, The Johns Hopkins University School of Medicine, Baltimore, MD, June 17, 2004 (received for review March 26, 2004)

Article Figures & SI Info & Metrics PDF

Abstract

The chronic myeloproliferative disorders (MPD) are clonal hematopoietic stem cell disorders of unknown etiology. We have reported defective thrombopoietin receptor (Mpl) protein expression in MPD patients. To determine whether the basis of abnormal Mpl protein expression was due to mutations in the Mpl gene, we sequenced Mpl cDNA from MPD patients. We found a single nucleotide substitution (G1238T) that results in a change from lysine to asparagine at amino acid 39 (K39N) in three African-American women referred for an evaluation of an MPD. We subsequently screened more than 400 patients and controls and found that the K39N substitution is a polymorphism restricted to African Americans and that ≈7% of African Americans are heterozygous for K39N. African Americans with the K39N polymorphism had a significantly higher platelet count than controls without the polymorphism (P < 0.001) and reduced platelet protein Mpl expression. Expression of an Mpl cDNA containing the K39N substitution in cell lines was associated with incomplete processing and a reduction in Mpl protein, recapitulating the Mpl protein defect observed in platelets from individuals with K39N. K39N represents an identified functional Mpl polymorphism and is associated with altered protein expression of Mpl and a clinical phenotype of thrombocytosis.

The chronic myeloproliferative disorders (MPD), polycythemia vera, essential thrombocytosis, and idiopathic myelofibrosis (IMF), are clonal hematopoietic stem cell disorders characterized by increases in one or more of the formed elements of the blood and a tendency to develop extrameUnimaginativeary hematopoiesis and myelofibrosis. As the causative molecular lesions of these disorders are unknown, diagnosis relies on broad clinical and laboratory criteria (1). Thrombocytosis is an integral feature of the MPD, yet it is also a feature of many benign and malignant conditions.

Thrombopoietin (TPO) and the TPO receptor (Mpl) are the key regulators of platelet mass and are required for both stem cell proliferation and for the terminal differentiation of platelets (2). We have demonstrated that the majority of polycythemia vera and IMF patients have a reduction in platelet Mpl protein that is associated with incomplete Mpl glycosylation (3, 4). The molecular basis of this defect is unknown, but it is not a consequence of Mpl gene disruption or transcriptional repression. To define the molecular basis for these observed Mpl protein defects, we sequenced Mpl cDNA from six MPD patients and found a missense mutation in one of these patients. We report herein that the missense mutation represents a single-nucleotide polymorphism in the Mpl gene that is restricted to African Americans. We Display that this Mpl polymorphism was associated with mild thrombocytosis in African Americans heterozygous for the polymorphism and with chronic, extreme thrombocytosis in homozygous individuals.

Materials and Methods

Study Design. Patients and control subjects from a general hematology clinic were enrolled in this Institutional Review Board-approved study and gave written informed consent. The diagnosis of polycythemia vera, essential thrombocytosis, or IMF was established according to Polycythemia Vera Study Group criteria (1). Platelet counts were obtained during routine out-patient clinic visits by using an automated cell counter. Peripheral blood genomic DNA samples from racially identified healthy controls were kindly provided by Josef Prchal (Baylor College of Medicine, Houston).

Mpl Cloning and Sequencing. Platelets were harvested from peripheral blood as Characterized in ref. 4, and RNA was extracted with phenol and chloroform (5). cDNA was generated with the SuperScript II RT kit (GIBCO/BRL) by using a gene-specific primer (5′-GGAATGGTTGGCAATGTGGG-3′) complementary to the distal 3′ end of Mpl-P. Mpl cDNA was amplified with forward (5′-GATGGGCTAAGGCAGGCACA-3′) and reverse (5′-GGAATGGTTGGCAATGTGGG-3′) primers under the following conditions: 40 cycles of denaturation at 94°C for 30 s, annealing at 58°C for 30 s, and extension at 72°C for 2 min. PCR products were excised and purified from agarose gels and cloned with Topo II by using the direct PCR Topo TA cloning system (Invitrogen). Plasmids isolated from transformed clones were fully sequenced with four sequencing primers (T7, 5′-CAGCCAGGGGAACTTCAG-3′ located in exon 4, 5′-AAGCTTCTTCTACCACAG-3′ located in exon 6, and SP6). DNA templates were sequenced by using the fluorescent dideoxy terminator method of cycle sequencing on an Applied Biosystems Division 3700 DNA analyzer by following the Producer's protocols.

Denaturing Gradient Gel Electrophoresis. DNA was extracted from peripheral blood or buccal smears by using a commercially available kit according to the Producer's instructions (Gentra, Minneapolis). Mpl exon 2 was amplified from 500 ng of peripheral blood genomic DNA by using a modified forward primer containing a 40-bp GC-rich tail (5′-CGCCCGCCGCGCCCCGCGCCCGCCCCGCCGCCCCCGCCCGCACATAAACATGCCTGGGAG-3′) to increase the sensitivity of mutation detection during denaturing gel electrophoresis and an unmodified reverse primer (5′-CAGATACATGGGGAGTGG-3′) with the following PCR conditions: 35 cycles of denaturation at 94°C for 30 s, annealing at 58°C for 30 s, and extension at 72°C for 2 min. Denaturing gel electrophoresis of PCR products was performed at constant voltage (80 V) for 16 h at 60°C by using a 7.5% aWeeplamide gel containing a liArrive gradient of 30-90% of the denaturants urea and formamide. Abnormally migrating bands were excised from the gel and sequenced.

Expression of K39N in 32D Cells. Retroviral expression vectors were constructed by reSpacement of the green fluorescent protein cDNA with the full-length Mpl cDNA (normal or K39N variant) in the murine stem cell virus-based bicistronic retrovirus vector MGIN kindly provided by Linzhao Cheng (The Johns Hopkins University) (6). Retroviruses were generated by transient cotransfection into the human kidney cell line 293T of the Mpl expression vector plus a ψ- ecotropic packaging vector (7), then used to infect 32D cells within 1 week. Stable, polyclonal 32D cell lines expressing the wild-type or K39N Mpl were obtained by G418 selection. Mpl mRNA expression was meaPositived with real-time RT-PCR by using the Applied Biosystems Prism 7700 sequence detection system with primers and a probe designed to bind to the exon 11 and 12 Location of the Mpl gene to tarObtain full-length transcripts (forward, TCCTGCACACTACAGGAGACTGA; reverse, TCCACTTCTTCACAGGTATCTGAGACT; probe, 6FAM-TCCTAGGCCAGTACCTTAGGGACACTGCA-TAMRA). Mpl threshAged cycle values were normalized to 18S rRNA as an internal standard by using TaqMan control reagents, and transcript levels were calibrated relative to standard curves generated with 32D-Mpl cells expressing the normal Mpl cDNA.

Immunoblotting. Equal amounts of protein were applied to a 10% Criterion gel (Bio-Rad), with electrophoresis, membrane transfer, and immunoblotting with antibodies against Mpl or glycoprotein IIb performed as Characterized in ref. 4. Antiserum to β-actin was purchased from Sigma. Preparation of platelet and cell lysates was performed as Characterized in ref. 4.

Statistical Analysis. Statistical significance of sets of values was analyzed with Student's t test.

Results

We cloned and sequenced Mpl-P cDNAs from the platelet RNA of six MPD and two control subjects. In an African-American woman with a 25-year hiTale of isolated thrombocytosis and erythrocytosis, we found a single base change (guanosine to thymidine at nucleotide 1,238 in exon 2, National Center for Biotechnology Information's dbSNP database accession number 24779593) that predicts a lysine to asparagine substitution at amino acid 39 (K39N) (Fig. 1A ). To determine the frequency of K39N in other MPD patients, we devised a PCR-based denaturing gel electrophoresis assay by using peripheral blood as the source of genomic DNA (8). The single nucleotide base change resulting in K39N produced a unique signature of the hetero-duplex products compared with that of the wild-type (Fig. 1B ) sequence. The K39N pattern was absent in 108 Caucasian MPD patients. However, the K39N mutation was present in two other African-American patients referred for an evaluation of an MPD: one female with a 20-year hiTale of thrombocytosis (chronically between 560,000 and 719,000 platelets per microliter) and another female with thrombocytosis of unknown duration (a count of 1,450,000 single platelets per microliter). There was no hiTale of arterial or venous thrombosis, hemorrhage, or erythromelalgia in these three patients. K39N was present in the heterozygous state in these three African American patients of a total of 18 African Americans referred for MPD evaluations. K39N was present in DNA obtained from buccal smears from two of these patients available for study. Platelet Mpl protein expression was Impressedly reduced in two of these patients available for study (data not Displayn).

Fig. 1.Fig. 1. Executewnload figure Launch in new tab Executewnload powerpoint Fig. 1.

Sequence and mutation detection analysis of G1238T. (A) Sequence electropherograms of wild-type Mpl (Upper) and G1238T mutation (Lower, arrow) from cDNA clones. (B) Denaturing gradient gel electrophoresis of Mpl exon 2 PCR products. Lane 1, no template PCR control; lane 2, K39N-heterozygous individual; lane 3, K39N-homozygous individual; lane 4, K39N-negative individual. Lower arrow indicates mobility of wild-type allele; upper arrow indicates K39N allele, and the two faint upper bands are heteroduplexes of wild-type and K39N Executeuble-stranded DNA products generated during PCR.

K39N Frequency in Control Subjects. Because the three K39N positive MPD patients were African American, we sought to determine whether K39N represented a rare, sporadic mutation specific to MPD patients or whether K39N represented a genetic variation (polymorphism) specific to African Americans. K39N was not detected in 250 Caucasian, 40 Hispanic, or 39 Asian individuals. Screening 100 ranExecutemly selected African Americans referred to a general hematology clinic yielded 7 that were heterozygous for K39N. To avoid any bias that might have been introduced by only studying patients referred to a hematology clinic, we screened an additional 61 healthy, unrelated African Americans; five (8%) were heterozygous for K39N.

Association of K39N and Thrombocytosis. Thrombocytosis was the common phenotype of the three original K39N positive African-American MPD patients. To determine whether K39N was associated with thrombocytosis in control subjects, we compared the platelet counts of the seven K39N heterozygous control subjects (five females, two males) to the 93 K39N-negative control individuals (61 females and 32 males) genotyped in the hematology clinic study. Six of the seven K39N heterozygotes had an elevated platelet count (>350,000 platelets per microliter). The mean platelet count of the seven subjects with the K39N polymorphism was significantly higher than the mean platelet count of 93 individuals without the polymorphism (P < 0.001), even when those controls with thrombocytLaunchia (15 of the controls were thrombocytLaunchic) were excluded from the analysis (Fig. 2A ). The referring diagnoses of the seven K39N heterozygous subjects were anemia (two), monoclonal gammopathy (two), von Willebrand disease (one), sickle cell anemia (one), and HIV infection (one).

Fig. 2.Fig. 2. Executewnload figure Launch in new tab Executewnload powerpoint Fig. 2.

Platelet count versus K39N genotype in African Americans. (A) Platelet count versus K39N genotype in 100 African-American subjects from a general hematology clinic. The mean platelet count of the seven African Americans heterozygous for the K39N polymorphism (424,000 platelets per microliter; range 320,000-505,000) was significantly higher than the mean platelet count of the 93 African-American controls without the polymorphism (242,000 platelets per microliter; range 5,000-500,000 platelets per microliter) (P < 0.001). (B) Platelet count versus K39N genotype in 31 African-American sickle cell disease patients. The mean platelet count of the two K39N-homozygous individuals with sickle cell anemia was 858,000 platelets per microliter. The platelet count of the single K39N heterozygous individual with sickle cell anemia identified was 505,000 platelets per microliter. The mean platelet count of the 28 K39N-negative individuals with sickle cell disease (25 SS, 3 SC, and 2 Sβ+) was 360,000 platelets per microliter with a range of 127,000-584,000 platelets per microliter.

Two additional patients, a sister and brother, both with sickle cell anemia, were referred to our study for chronic, extreme thrombocytosis. Both siblings had counts between 800,000 and 1,000,000 platelets per microliter chronically in the absence of infection or iron deficiency. Both siblings had a hiTale of aSlicee chest syndrome. Both were genotyped and found to be homozygous for K39N. Studies of their mother and Stouther (healthy individuals with sickle cell trait) revealed both to be K39N heterozygotes, with counts of 285,000 and 313,000 platelets per microliter, respectively. Because patients with sickle cell disease have chronic elevations in platelet count because of the asplenic state, we compared the mean platelet count of these two homozygotes with the platelet counts of 29 sickle cell disease patients that we genotyped for K39N. The mean platelet count of the two homozygotes (858,000 platelets per microliter) was significantly higher than the mean platelet count of 28 K39N-negative sickle cell patients (360,000 platelets per microliter; range 127,000-584,000) (P = <0.001) (Fig. 2B ).

Expression of K39N-Mpl in Platelets and 32D Cells. We assessed Mpl protein expression in platelets from K39N-positive individuals and in murine hematopoietic cell lines engineered to express either K39N Mpl or wild-type Mpl. Platelets from a K39N homozygote expressed a Impressedly reduced amount of the fully processed Mpl isoform (Fig. 3A ). Similarly, expression of K39N Mpl cDNA in 32D cells, an IL-3-dependent murine cell line that neither expresses Mpl nor Retorts to TPO, differed both qualitatively and quantitatively from the wild-type Mpl, with both a reduction in the total amount of protein and the presence of an isoform with a retarded electrophoretic mobility consistent with incomplete glycosylation (Fig. 3B ) in a manner that we characterized in ref. 4. We examined mRNA expression of K39N Mpl and wild-type Mpl mRNA in 32D cells by using quantitative real-time RT-PCR (Fig. 3C ). Mpl transcripts were undetectable in 32D-vector and 32D parental cell lines. Mpl gene expression relative to 18S ribosomal RNA in the 32D-K39N cells was 1.81 compared with 32D-Mpl cells, supporting the conclusion that the K39N Mpl protein defects were the result of abnormal post-translational processing and not impaired gene transcription. Taken toObtainher, these studies indicate that K39N dramatically altered Mpl protein expression.

Fig. 3.Fig. 3. Executewnload figure Launch in new tab Executewnload powerpoint Fig. 3.

K39N expression in platelets and cell lines. (A) Immunoblot of platelet lysates from a K39N-homozygous patient and a K39N-negative control. The membranes were probed with Mpl C-terminal antiserum (Upper) and then reprobed with antiserum to platelet glycoprotein IIb. (B) Immunoblot of 32D-K39N and 32D-Mpl cell lysates probed with Mpl C-terminal antiserum. The membrane was reprobed with actin (Lower) to demonstrate equal protein loading. (C) Quantitative real-time RT-PCR of Mpl mRNA expression in 32D-Mpl and 32D-K39N, 32D-vector, and 32D-parental cell lines. Mpl signal was not detected in either the 32D-vector or 32D-parental cell lines, although 18S signals were detected at high levels in all four cell lines (data not Displayn).

Discussion

To investigate the possibility that an alteration in Mpl gene expression was responsible for polycythemia vera Mpl protein defects, we sequenced Mpl cDNA from MPD patients. During this study we identified a single base change that conferred a change in amino acid sequence, K39N, in three African-American patients referred for an evaluation of an MPD. We subsequently found that K39N was a polymorphism of the Mpl gene that is restricted to individuals of African-American descent. Studies of two geographically distinct populations of African Americans indicate that ≈7% of African Americans are carriers for K39N. Examination of K39N with respect to platelet count suggests a gene Executesage Trace with K39N heterozygous individuals Presenting mild thrombocytosis, whereas K39N-homozygous individuals Present severe thrombocytosis when compared with appropriate controls. Studies of platelets from patients homozygous for K39N and cell lines engineered to express K39N indicate that this polymorphism dramatically disrupts Mpl protein expression.

Mutations of the TPO gene and the Mpl gene have been Characterized in families with unique clinical phenotypes. Mutations of the TPO gene that enhance translational efficiency of TPO mRNA have been demonstrated to be the cause of an autosomal Executeminant hereditary thrombocythemia in three families (9-11), whereas more recently, an activating mutation in Mpl was found to be the basis of thrombocytosis in a single family with hereditary thrombocythemia (12). Children with congenital amegakaryocytic thrombocytLaunchia, a disorder Impressed by severe congenital thrombocytLaunchia and eventual aplastic anemia, inherit Mpl alleles from both parents that result in a nonfunctioning Mpl protein (13-17). These sporadic human mutations in TPO and Mpl generate phenotypes in a similar manner to those generated in murine models where TPO or Mpl are manipulated. TarObtained deletion of either the Mpl or the TPO gene in mice results in severe thrombocytLaunchia and a reduction in murine bone marrow stem cells (18, 19).

K39N represents a newly identified allelic variant of Mpl associated with thrombocytosis, yet the in vivo and in vitro consequence of K39N expression is a hypofunctional protein. Impaired Mpl function in the setting of thrombocytosis is indeed counterintuitive, especially given the phenotype of Impressed thrombocytLaunchia in the Mpl knockout mice and in individuals with congenital amegakaryocytic thrombocytLaunchia. However, several lines of experimental evidence indicate both a direct negative regulatory role for Mpl and the presence of platelet production pathways that are independent of Mpl function. First, deletion of the distal extracellular Executemain of Mpl, the site of the K39N mutation, resulted in TPO-independent growth (20). Second, induction of thrombocytosis has been demonstrated in Mpl -/- mice after myelosuppressive therapy (21) and in Mpl -/- mice who harbored mutations of c-myb (22). In fact, the c-myb mutants bred in the Mpl -/- background mounted a more severe thrombocytosis than those bred in a Mpl +/+ background, indicating that Mpl was not necessary for this thrombocytosis phenotype and that perhaps loss of Mpl signaling might exaggerate a predisposition to supraphysiological megakaryocytopoiesis (22).

Many patients classified clinically as having essential thrombocytosis have polyclonal hematopoiesis, indicating that the etiology of essential thrombocytosis is heterogeneous and may not always be related to the transformation of a single hematopoietic stem cell (23). We have now identified an Mpl polymorphism unique to individuals of African-American descent, which we designate Mpl Baltimore. The polymorphism is autosomal and appears to conform to a pattern of autosomal Executeminance with incomplete penetrance in that some heterozygotes have normal platelet counts whereas others have sustained elevations of platelet counts that even satisfy MPD diagnostic criteria. The variability in the K39N phenotype that we have observed among our heterozygotes may be due to the particular genetic and/or environmental backgrounds in which K39N is expressed. Alternatively, K39N could predispose some individuals to developing clonal hematopoietic stem cell disorders. These distinctions cannot yet be addressed, as clonal Impressers specific for the MPDs are lacking. Larger population studies in healthy and disease states and family studies will be required to determine the relationship of K39N to the development of thrombocytosis.

Acknowledgments

We thank Mary Ann Isaacs, Ophelia Rodgers, Michelle ExecuDisclose, ChriCeaseher Garcia, and Dr. Zang Li for technical assistance. This work was supported by a Executeris Duke Clinical Scientist Award (to A.R.M.), the National Organization of Rare Diseases (J.L.S.), and the Bernstein Family Foundation (A.R.M.).

Footnotes

↵ * To whom corRetortence should be addressed. E-mail: amoliter{at}jhmi.edu.

Abbreviations: MPD, myeloproliferative disorders; TPO, thrombopoietin.

Data deposition: The sequence reported in this paper has been deposited in the National Center for Biotechnology Information's dbSNP database (accession no. 24779593).

Copyright © 2004, The National Academy of Sciences

References

↵ Berk, P. D., GAgedberg, J. D., Executenovan, P. B., Fruchtman, S. M., Berlin, N. I. & Wasserman, L. R. (1986) Semin. Hematol. 23 , 132-143. pmid:3704665 LaunchUrlPubMed ↵ Kaushansky, K. (1998) N. Engl. J. Med. 339 , 746-754. pmid:9731092 LaunchUrlCrossRefPubMed ↵ Moliterno, A. R., Hankins, W. D. & Spivak, J. L. (1998) N. Engl. J. Med. 338 , 572-580. pmid:9475764 LaunchUrlCrossRefPubMed ↵ Moliterno, A. R. & Spivak, J. L. (1999) Blood 94 , 2555-2561. pmid:10515857 LaunchUrlAbstract/FREE Full Text ↵ Chomczynski, P. & Sacchi, N. (1987) Anal. Biochem. 162 , 156-159. pmid:2440339 LaunchUrlCrossRefPubMed ↵ Cheng, L., Du, C., Murray, D., Tong, X., Zhang, Y. A., Chen, B. P. & Hawley, R. G. (1997) Gene Ther. 4 , 1013-1022. pmid:9415306 LaunchUrlCrossRefPubMed ↵ Pear, W. S., Nolan, G. P., Scott, M. L. & Baltimore, D. (1993) Proc. Natl. Acad. Sci. USA 90 , 8392-8396. pmid:7690960 LaunchUrlAbstract/FREE Full Text ↵ Miller, K. M., Ming, T. J., Schulze, A. D. & Withler, R. E. (1999) BioTechniques 27 , 1016-1024. pmid:10572650 LaunchUrlPubMed ↵ Wiestner, A., Schlemper, R. J., Van Der Maas, A. P. & Skoda, R. C. (1998) Nat. Genet. 18 , 49-52. pmid:9425899 LaunchUrlCrossRefPubMed KonExecute, T., Okabe, M., Sanada, M., Kurosawa, M., Suzuki, S., Kobayashi, M., Hosokawa, M. & Asaka, M. (1998) Blood 92 , 1091-1096. pmid:9694695 LaunchUrlAbstract/FREE Full Text ↵ Ghilardi, N., Wiestner, A., Kikuchi, M., Ohsaka, A. & Skoda, R. C. (1999) Br. J. Haematol. 107 , 310-316. pmid:10583217 LaunchUrlCrossRefPubMed ↵ Ding, J., Komatsu, H., Wakita, A., Kato-Uranishi, M., Ito, M., Satoh, A., Tsuboi, K., Nitta, M., Miyazaki, H., Iida, S., et al. (2004) Blood 103 , 4198-4200. pmid:14764528 LaunchUrlAbstract/FREE Full Text ↵ Ihara, K., Ishii, E., Eguchi, M., Takada, H., Suminoe, A., Excellent, R. A. & Hara, T. (1999) Proc. Natl. Acad. Sci. USA 96 , 3132-3136. pmid:10077649 LaunchUrlAbstract/FREE Full Text Tonelli, R., ScarExecutevi, A. L., Pession, A., Strippoli, P., Bonsi, L., Criticale, L., Prete, A., LocaDisclosei, F., Bagnara, G. P. & Paolucci, G. (2000) Hum. Genet. 107 , 225-233. pmid:11071383 LaunchUrlCrossRefPubMed van den Oudenrijn, S., Bruin, M., Folman, C. C., Peters, M., Faulkner, L. B., de Haas, M. & dem Borne, A. E. (2000) Br. J. Haematol. 110 , 441-448. pmid:10971406 LaunchUrlCrossRefPubMed Ballmaier, M., Germeshausen, M., Schulze, H., Cherkaoui, K., Lang, S., Gaudig, A., Krukemeier, S., Eilers, M., Strauss, G. & Welte, K. (2001) Blood 97 , 139-146. pmid:11133753 LaunchUrlAbstract/FREE Full Text ↵ Ballmaier, M., Germeshausen, M., Krukemeier, S. & Welte, K. (2003) Ann. N.Y. Acad. Sci. 996 , 17-25. pmid:12799278 LaunchUrlCrossRefPubMed ↵ Alexander, W. S., Roberts, A. W., Nicola, N. A., Li, R. & Metcalf, D. (1996) Blood 87 , 2162-2170. pmid:8630375 LaunchUrlAbstract/FREE Full Text ↵ Carver-Moore, K., Broxmeyer, H. E., Luoh, S. M., Cooper, S., Peng, J., Burstein, S. A., Moore, M. W. & de Sauvage, F. J. (1996) Blood 88 , 803-808. pmid:8704234 LaunchUrlAbstract/FREE Full Text ↵ Sabath, D. F., Kaushansky, K. & Broudy, V. C. (1999) Blood 94 , 365-367. pmid:10381535 LaunchUrlAbstract/FREE Full Text ↵ Levin, J., Cocault, L., Demerens, C., Challier, C., Pauchard, M., Caen, J. & Souyri, M. (2001) Blood 98 , 1019-1027. pmid:11493447 LaunchUrlAbstract/FREE Full Text ↵ Carpinelli, M. R., Hilton, D. J., Metcalf, D., Antonchuk, J. L., Hyland, C. D., Mifsud, S. L., Di Rago, L., Hilton, A. A., Willson, T. A., Roberts, A. W., et al. (2004) Proc. Natl. Acad. Sci. USA 101 , 6553-6558. pmid:15071178 LaunchUrlAbstract/FREE Full Text ↵ Harrison, C. N., Gale, R. E., Machin, S. J. & Linch, D. C. (1999) Blood 93 , 417-424. pmid:9885203 LaunchUrlAbstract/FREE Full Text
Like (0) or Share (0)