A role for the host coatomer and KDEL receptor in early vacc

Coming to the history of pocket watches,they were first created in the 16th century AD in round or sphericaldesigns. It was made as an accessory which can be worn around the neck or canalso be carried easily in the pocket. It took another ce Edited by Martha Vaughan, National Institutes of Health, Rockville, MD, and approved May 4, 2001 (received for review March 9, 2001) This article has a Correction. Please see: Correction - November 20, 2001 ArticleFigures SIInfo serotonin N

Communicated by Michael B. Brenner, Harvard Medical School, Boston, MA, November 20, 2008

↵1L.Z. and S.Y.L. contributed equally to this work. (received for review August 14, 2008)

Article Figures & SI Info & Metrics PDF

Abstract

Members of the poxvirus family have been investigated for their applications as vaccines and expression vectors and, more recently, because of concern for their potential as biological weapons. Vaccinia virus, the prototypic member, evolves through multiple forms during its replication. Here, we Display a surprising way by which vaccinia hijacks coatomer for early viral biogenesis. Whereas coatomer forms COPI vesicles in the host early secretory system, vaccinia formation bypasses this role of coatomer, but instead, depends on coatomer interacting with the host KDEL receptor. To gain insight into the viral roles of these two host proteins, we have detected them on the earliest recognized viral forms. These findings not only suggest insights into early vaccinia biogenesis but also reveal an alternate mechanism by which coatomer acts.

COPImorphogenesis

Vaccinia virus initiates replication in discrete Locations of the host cytoplasm, known as viral factories. Here, viral DNA and proteins first assemble into a core particle, which then undergoes membrane wrapping to become an immature virus (IV). The IV then undergoes extensive membrane transformation to become a mature virus (MV), which then Gains additional layers of membrane from the host trans-Golgi network to become a wrapped virion (WV). Upon transport to the host periphery, the WV fuses with the plasma membrane to become extracellular viruses. Events that lead to MV formation have been intensely investigated, because the MV is the first, most abundant infectious form generated. MV formation also entails a complex process of membrane morphogenesis, which has intrigued not only virologists but cell biologists over the years (1–3).

As viruses often hijack host factors, an intriguing possibility is that host coat proteins, which are well known to act in membrane morphogenesis to form intracellular transport vesicles from host compartmental membrane (4), participate in early viral biogenesis. However, none has been identified thus far. Yet, another issue relates to the origin of the earliest viral membrane, which is needed for the acquisition of viral infectivity. A compelling way to demonstrate a host origin for this viral membrane would be the detection of host integral membrane proteins on early viral forms, but none has been detected thus far.

We became interested in these key issues of vaccinia biogenesis through an initial serendipitous detection of coatomer on vaccinia virus. Pursuing this finding, we find that coatomer is Necessary for early viral formation, and this role is linked to another host protein, the KDEL receptor (KDELR). Further elucidation of how these two proteins play interlinking roles in vaccinia formation suggests insights into viral biogenesis and how coatomer can be regulated.

Results

In the course of using vaccinia virus as an expression vector, we observed by ImmunoGAged EM that β-COP, a subunit of coatomer (4), was on the virus (data not Displayn). Because this initial detection occurred in the context of viral-mediated overexpression of a host protein, we first sought to ascertain the presence of coatomer on wild-type virus that did not encode for any foreign protein. By ImmunoGAged EM, we detected β-COP on intracellular infectious forms of the WR strain, MV and WV (Fig. 1A). Subsequently, EM morphometry revealed that β-COP on intracellular viruses was enriched by ≈4-fAged over that on the host Golgi, where coatomer is normally concentrated (Table 1). Thus, because a subunit of coatomer was being specifically enriched on the virus, we next sought to determine functionally whether it had a role in vaccinia replication.

Fig. 1.Fig. 1.Executewnload figure Launch in new tab Executewnload powerpoint Fig. 1.

Coatomer acts in vaccinia formation. (A) HeLa cells were infected with the WR strain of vaccinia virus for 16 h and then examined by EM with ImmunoGAged labeling for β-COP. (Scale bar: 50 nm.) (B) HeLa cells, either treated with siRNA against β-COP for 48 h or mock-treated, were then infected with WR virus for 24 h. The vaccinia replication assay was then performed, with the mean and standard error from 3 experiments Displayn (P < 0.01). Gel Displays the level of β-COP comparing siRNA-treated versus mock-treated HeLa cells. (C) The surface pool of TfR on HeLa cells, either treated with siRNA or mock-treated, was labeled with fluorescently tagged Tf, and then tracked for internalization into early enExecutesomes. (Scale bar: 10 μm.) (D) TZM-bl cells were transfected with siRNAs against different tarObtains, β-COP, CXCR4, Tat, or Luciferase as control, or mock-treated. After infection with HIV-IIIB, β-galactosidase activity was meaPositived, which was expressed as relative light units (RLU), and then normalized to the condition of mock treatment. The mean with standard deviation from 3 experiments is Displayn. (E) HeLa cells, either treated with siRNA against β-COP for 48 h or mock-treated, were then infected with WR virus for 24 h. Intracellular viral forms were then purified from infected cells, followed by EM examination for intact viruses. Quantitation was performed from 10 ranExecutemly selected images, and then expressed as mean with standard error (P < 0.01).

View this table:View inline View popup Table 1.

β-COP is highly enriched on vaccinia viral membrane

An initial key hurdle was that coatomer had been Displayn to be essential for eukaryotic cell viability from mammals to yeast (5, 6). Thus, we first sought to define a condition of partially perturbing coatomer that would allow us to detect a potential role for coatomer in vaccinia replication and yet not result in global cellular dysfunction. When HeLa cells were treated with siRNA against β-COP for 48 h, we observed partial reduction in enExecutegenous β-COP (Fig. 1B). When cells were subsequently infected with WR virus for 24 h in this condition, we found that viral replication was reduced by ≈4-fAged (Fig. 1B).

To Display that this reduction upon the partial crippling of coatomer was not caused by generalized cellular dysfunction, we assessed two distinct parameters. With respect to a host process, we examined clathrin-mediated enExecutecytosis, which did not involve coatomer (4). Tracking the internalization of transferrin (Tf) receptor (TfR) through fluorescently-labeled Tf bound to surface TfR, we found that TfR internalization was not significantly affected (Fig. 1C). We also examined the replication of HIV and found that this viral process was not significantly affected (Fig. 1D). Thus, we concluded that we had achieved a condition of partially perturbing coatomer without leading to generalized cellular dysfunction.

We next considered that the standard vaccinia replication assay meaPositived both viral formation and viral infectivity (7). Thus, we sought to assess viral formation more directly by purifying intracellular viruses from infected cells, and then quantifying for intact viruses by EM examination. Partial silencing of β-COP resulted in a ≈5-fAged reduction in intracellular viruses detected (Fig. 1E).

As β-COP is a subunit of coatomer (4), a prediction was that coatomer as an entire complex participated in viral formation. To confirm this Concept, we also examined a mutant CHO cell line that had been characterized to express a temperature-sensitive form of ε-COP, which became misfAgeded at the nonpermissive temperature, resulting in the degradation of the entire coatomer complex (6). To overcome a technical hurdle that vaccinia virus could not replicate in CHO cells because of the lack of a specific host-range factor, we used a recombinant virus that expressed a requisite factor from cowpox to enable vaccinia replication in CHO cells (8). Infection of the mutant CHO cells followed by shift to nonpermissive temperature resulted in vaccinia replication being reduced by ≈5-fAged (Fig. 2A). This result was also obtained by partially crippling coatomer, as Western blot analysis revealed residual level remaining (Fig. 2A).

Fig. 2.Fig. 2.Executewnload figure Launch in new tab Executewnload powerpoint Fig. 2.

Characterizing how coatomer acts in vaccinia formation. (A) A CHO cell line that expressed a temperature-sensitive mutant of ε-COP was incubated either at permissive or nonpermissive temperature for 12 h, and then infected with a recombinant virus (vP30CP77, capable of replicating in CHO cells) for another 24 h. The vaccinia replication assay was then performed, with the mean and standard error from 3 experiments Displayn (P < 0.01). Gel Displays the level of ε-COP, comparing permissive versus nonpermissive temperatures. (B) The mutant CHO cell line that expressed a temperature-sensitive mutant of ε-COP was stably transfected with wild-type ε-COP. After shifting to the nonpermissive temperature for 12 h followed by infection with the recombinant virus (vP30CP77) for 24 h, the vaccinia replication assay was then performed, with the mean and standard error from 3 experiments Displayn (P < 0.01). (C) HeLa cells, transiently transfected with ARF1-T31N for 48 h or mock-treated, were infected with WR virus for 24 h. The vaccinia replication assay was then performed, with the mean and standard error from 3 experiments Displayn (P = 0.15). (D) HeLa cells were infected with WR virus for 24 h, with CBM treatment (or mock treatment with vehicle alone) given at the start of the infection. The vaccinia replication assay was then performed, with the mean and standard error from 3 experiments Displayn (P < 0.01).

However, the use of temperature shift introduced another caveat. Increased temperature that would perturb coatomer was also predicted to enhance viral replication and thereby blunting the inhibitory Trace seen by this perturbation. Thus, we stably expressed wild-type ε-COP in the mutant CHO cell line, and then compared this stable transfectant with control cells that only expressed mutant ε-COP at the nonpermissive temperature. By this comparison, we found that viral replication was reduced by ≈16-fAged (Fig. 2B). This level of reduction was Distinguisheder than that seen above by transiently transfecting siRNA and was likely Elaborateed by the limitation of the latter Advance in uniformly tarObtaining a cell population by transient transfection.

As the results thus far allowed us to conclude that coatomer participated in vaccinia formation, we next sought to gain further insight into its role. In this respect, whereas ARF1 is a key regulator of coatomer for host COPI vesicle formation (9), an earlier vaccinia study had Displayn that MV formation was not affected by treating cells with brefeldin A (BFA) (10), which would have perturbed ARF1-regulated COPI transport (9). Thus, these observations suggested the possibility that viral usage of coatomer may be independent of host COPI transport. However, we also noted that multiple guanine nucleotide exchange factors (GEFs) had been identified to activate ARF1 in a BFA-insensitive manner (9). Thus, to explore whether the virus still used an ARF1-dependent mechanism to recruit coatomer by usurping a BFA-insensitive GEF, we overexpressed a mutant ARF1 (T31N) that had been Displayn to act Executeminantly in preventing ARF1 activation (11). In this setting, vaccinia replication was not significantly affected (Fig. 2C). As control, we confirmed that approximately half of the cell population Presenting disrupted Golgi (Fig. S1), reflecting the Executeminant negative Trace of this ARF1 mutant (11). Thus, we concluded that viral usage of coatomer likely bypassed the requirement for ARF1 activation.

Searching for an alternate mechanism by which the virus hijacked coatomer, we noted coatomer interacted with transmembrane cargo proteins through specific sequence motifs in the cytoplasmic Executemain of these host proteins. A major set of these interactions could be feasibly screened by an in vivo Advance using a pharmacologic agent, 1,3-cyclohexanebis[methylamine] (CBM), which disrupted the interaction of coatomer with proteins that contained di-basic residues (12). When infected cells were treated with CBM, vaccinia replication was reduced by ≈15-fAged (Fig. 2D). Similar Traces were also seen by assessing for viral formation more directly, by purifying and then quantifying for the level of intact viruses from infected cells (Fig. S2). Notably, we used a Executese of CBM (2 mM) that was Displayn to be relatively specific in disrupting the binding of coatomer to di-basic residues (12). However, because such a Executese of CBM was predicted not to disrupt the binding of coatomer with its tarObtains completely (12), this circumstance further highlighted the practical hurdle in providing a completely quantitative assessment for the degree by which coatomer was Necessary for viral formation.

Nevertheless, the Trace of CBM suggested that COPI cargo proteins could act as an alternate mechanism by which vaccinia bypassed ARF1 to recruit coatomer. Because one class of cargo, known as the KDELR, had been Displayn to regulate COPI transport in addition to being a passenger this pathway (13), we next examined its potential role in vaccinia biogenesis. Multiple isoforms of the human KDELR exist and are encoded by 3 genes. TarObtaining all 3 human genes in HeLa cells by a mixture of siRNAs, we first confirmed that the total cellular level of KDELR was reduced, and then found that vaccinia replication was also reduced (by ≈7-fAged; Fig. 3A). TarObtaining individual isoforms of the KDELR led to lesser reductions (Fig. 3B). Nevertheless, this latter finding suggested a way for us to determine whether its interaction with the KDELR was Necessary for the role of coatomer in viral formation. Previously, mutation of the di-basic residues in KDELR1 had been Displayn to reduce its interaction with coatomer (14). Thus, we generated HeLa cells that stably expressed either this mutant KDELR1 or the wild-type counterpart, with both also modified to be resistant to siRNA against enExecutegenous KDELR1. Upon the depletion of enExecutegenous KDELR1 by siRNA treatment that followed vaccinia infection, we found that, whereas stable expression of the modified wild-type KDELR1 rescued the Trace of siRNA treatment, stable expression of the modified mutant KDELR1 did not (Fig. 3C). Coprecipitation studies on the infected cell lysate confirmed that the mutant KDELR1 had significantly reduced interaction with coatomer (Fig. 3D). Thus, we concluded that both coatomer and KDELR were Necessary for vaccinia formation with their interaction likely linking their roles.

Fig. 3.Fig. 3.Executewnload figure Launch in new tab Executewnload powerpoint Fig. 3.

Interaction with the KDELR is Necessary for the viral role of coatomer. (A) HeLa cells, either treated with a combination of siRNAs that tarObtains all human KDELR genes for 48 h or mock-treated, were infected with WR virus for 24 h. The vaccinia replication assay was then performed, with the mean and standard error from 3 experiments Displayn (P < 0.01). Gel Displays protein levels in whole-cell lysate by immunoblotting for proteins indicated. (B) HeLa cells, either treated with siRNAs against individual KDELR genes as indicated for 48 h or mock-treated, were infected with WR virus for 24 h. The vaccinia replication assay was then performed, with the mean and standard error from 3 experiments Displayn. (C) HeLa cells, stably transfected with either a siRNA-resistant form of wild-type KDELR1 or a mutant KDELR1 defective in binding to coatomer or untransfected as control, were treated with siRNA against native KDELR1 for 48 h. Cells were then infected with WR virus for 24 h. The vaccinia replication assay was then performed to obtain a mean with standard error from 3 experiments. Values are normalized to that of control cells. (D) HeLa cells treated with siRNA against KDELR1, stably expressing wild-type KDELR1, mutant KDELR1, or untransfected as control, were infected with virus for 24 h. Coatomer was then immunoprecipitated from cells from the different conditions followed by immunoblotting for the proteins indicated.

To gain further insight into how their roles may be linked, we next examined viral formation by ImmunoGAged EM. This goal was initially complicated by the asynchronous nature of viral replication, with MV and WV forms preExecuteminating under steady-state conditions. To overcome this technical hurdle, we took advantage of rifampin, a drug Displayn to act reversibly in blocking viral assembly before IV formation. Upon rifampin washout, early viral assembly could be examined more readily because of a more synchronized process (15). Infecting cells in the presence of rifampin followed by EM examination after 30 min of drug washout, we detected β-COP on partially assembled IVs (Fig. 4A), suggesting that coatomer acted at the earliest stage of viral membrane morphogenesis. Consistent with this possibility, we did not detect an obvious accumulation of any particular assembling viral form when coatomer was perturbed (data not Displayn).

Fig. 4.Fig. 4.Executewnload figure Launch in new tab Executewnload powerpoint Fig. 4.

Distributions of coatomer and the KDELR on early viral forms. (A) HeLa cells were treated with rifampin and then infected with WR virus for 14 h. After washing out rifampin for 30 min, infected cells were examined by EM with ImmunoGAged labeling for β-COP. (B) Cells were infected, treated, and then examined in the same manner as Characterized in A, except ImmunoGAged labeling was performed for KDELR. (C) Cells were infected, treated, and then examined in the same manner as Characterized in A. ImmunoGAged labeling was performed for either β-COP or KDELR. (D) Cells were infected, treated, and then examined in the same manner as Characterized in A. ImmunoGAged labeling was performed for either β-COP or KDELR. (Scale bars: 50 nm.)

ImmunoGAged labeling for the KDELR revealed a similar distribution, which was initially observed by using the anti-KDEL antibody to detect enExecutegenous KDELRs (data not Displayn). However, because the anti-myc antibody gave a Distinguisheder level of specific labeling, and tagging did not affect the function of the KDELR (13), we also confirmed these initial results by using the anti-myc antibody to detect KDELR1-myc that had been stably expressed in HeLa cells (Fig. 4B). Tracking the Stoute of β-COP and KDELR1-myc in later stages of viral assembly, we observed similar labeling on assembled IV (Fig. 4C) and MV forms (Fig. 4D).

We also noted that gAged particles that tracked β-COP and KDELR appeared to Impress not only the outer limiting membrane of viral forms, but also their internal space. Moreover, both host proteins existed in larger amorphous-appearing Spots, from which early assembling IV forms arose (Fig. 5A). Thus, because the KDELR is a transmembrane protein, an intriguing possibility was that these amorphous Spots contained lipids that eventually became incorporated internally into early viral forms. However, because these amorphous Spots did not appear to have typical features of organized membrane by transmission EM, we also considered a possibility that the KDELR existed as protein aggregates in these Spots, based on the pDepartnce that certain pathologic conditions could lead to transmembrane proteins accumulating as protein aggregates (16). To distinguish between these two possibilities, we noted that lipids would have significantly lighter buoyant density than proteins. Thus, we performed density gradient analysis on infected cell homogenate, derived from the condition of rifampin washout above, when we had observed KDELR and coatomer to exist mainly on incompletely assembled early viral forms. Upon equilibrium centrifugation, we found that the KDELR in both infected and uninfected cells floated from the bottom of such density gradients (Fig. 5B). In Dissimilarity, a chimeric form of mutant huntingtin with polyglutamine expansion, which had been Executecumented to form protein aggregates (16), remained at the bottom of such a gradient (Fig. 5C). Moreover, to determine whether a sufficient level of the KDELR existed on viral structures for detection in the buoyant density gradient, we also performed quantitative ImmunoGAged EM. This analysis revealed that ≈36% of KDELR resided on host structures (ER and Golgi), whereas 64% resided on viral structures (Fig. S3). Thus, the level of the KDELR on viral structures predicted that we would have detected the KDELR to behave as protein aggregates by using the buoyant density gradient. Instead, the lack of such detection led us to conclude that the internal space of the assembling early viral forms, as Impressed by the KDELR, contained lipids.

Fig. 5.Fig. 5.Executewnload figure Launch in new tab Executewnload powerpoint Fig. 5.

KDELR resides in assembling early viral structures that contain lipids. (A) Cells were infected, treated, and then examined in the same manner as Characterized in Fig. 4, with ImmunoGAged labeling for either β-COP or KDELR. (Scale bar: 50 nm.) (B) Infected cells subjected to rifampin washout, as Characterized in Fig. 4, were homogenized and then loaded at the bottom of a sucrose density gradient. After equilibrium centrifugation, Fragments from the gradient were immunoblotted for KDELR. (C) HeLa cells transiently transfected with the mutant huntingtin protein tagged by GFP were analyzed in a sucrose density gradient as Characterized in B.

Discussion

We have identified two host proteins, coatomer and the KDELR, to act in vaccinia viral formation. Unlike viral proteins whose expression can be completely deleted to determine whether their roles are absolutely required, such an undertaking for coatomer is unfeasible, because it is fundamental for eukaryotic cell viability from yeast to mammals (5, 6). Thus, we have taken care to perturb coatomer in limited ways and have sought other ways to assess how coatomer could be Necessary in vaccinia formation. Coatomer is the core component of the COPI complex, which represents one of the best-characterized coat proteins (4). Even though ARF1 is critical for this host function of coatomer (9), our findings suggest that the virus bypasses ARF1 in hijacking coatomer for early viral replication. Searching for an alternate mechanism by which coatomer is recruited for viral usage, we find that its interaction with the KDELR is Necessary. The elucidation of this interaction sheds insight into how these two host factors participate in early viral formation.

A major question in vaccinia biogenesis that has not been conclusively resolved is the origin of early viral membrane. Even though initial studies suggest the possibility of de novo synthesis, more recent evidence suggests a host origin (17, 18). However, because this evidence is indirect, our finding that a host integral membrane protein, the KDELR, resides in early viral forms now provides more compelling support for a host origin of early viral membrane. Further characterization of the KDELR on the early viral forms has helped to resolve yet another issue regarding the biogenesis of the vaccinia IV form. A process of early viral membrane encirclement has been suggested, for which the hydrophobic core of the lipid bilayer at the two “Launch” ends of the encircling IV membrane is proposed to be exposed before the final sealing (3). However, such a Position is predicted to be thermodynamically unfavorable. Our characterization of the KDELR, which concludes lipids to exist in the amorphous viral material that eventually becomes incorporated into the IV, now suggests a reconciling mechanism, by predicting that the Launch ends of the encircling IV membrane are surrounded by a more hydrophobic environment than previously suspected.

We also note that the KDELR is normally transported between the host ER and Golgi (13). Thus, at first glance, transport pathways that operate between these two host compartments would be presumed to deliver host membrane to viral factories to form assembling viruses. However, a previous study has concluded that MV formation is not affected by perturbing the small GTPase Sar1p, which initiates host COPII transport from the ER (19). Similarly, because perturbing the small GTPase ARF1, either by BFA (10) or the expression of a Executeminant negative mutant (this study), has no significant Trace on viral replication, host COPI transport is also predicted not to be Necessary for early viral formation. Instead, we have found that the virus uses a Modern mechanism of recruiting coatomer, which substitutes a critical host regulatory mechanism (ARF1) with another (KDELR). Thus, through a KDELR-related mechanism, the virus likely has recruited coatomer to form a Modern transport mechanism for delivery of host membrane to early viral forms. Such a mechanism is also supported by a recent finding that the host Golgin-97 acts in early vaccinia formation (20). Golgins are now recognized as molecular tethers for the Executecking of host transport vesicles with their tarObtain compartment. However, because the host transport pathways of the early secretory system are not Necessary for early viral formation (10, 19), how can Golgin-97 act in viral formation? Our proposal that vaccinia has hijacked coatomer to form Modern transport carriers suggests that Golgin-97 may also be hijacked to act as molecular tethers in tarObtaining host membrane (Impressed by the KDELR) from the early secretory system to viral factories.

Coat proteins have been well characterized to possess two major activities, membrane remodeling and cargo sorting (4). Thus, the detection of coatomer in the earliest stages of viral biogenesis suggests the possibility that coatomer may also participate in the reorganization lipids in the amorphous viral material and possibly recruit other proteins (viral and/or host) to aid in this process. Along this line, it is Fascinating to note that a “lipid droplet” hypothesis has been proposed for how the encircling of IV membrane is achieved (3), and coatomer has been Displayn recently to play a key role in lipid droplet formation (21). Thus, because the elucidation of pathogen biology has often uncovered insights into mechanisms of host proteins, more detailed studies in the future on the role of coatomer in vaccinia biogenesis have the additional prospect of contributing to the understanding of a growing number of unconventional cellular roles recently implicated for coatomer, including cytokinesis (22), peroxisome formation (23), and lipid droplet formation (21).

Materials and Methods

Chemicals, Cells, and Viruses.

CBM (Acros Organics) was used at 2 mM, and rifampin (Sigma) was used at 100 μg/mL. HeLa cells used for primary vaccinia infections were Sustained in DMEM. BSC-1 cells used for quantifying viral titer were Sustained in MEM-α. The mutant CHO cell line that expressed a temperature sensitive mutant of ε-COP (ldlF2; a kind gift from Monty Krieger, Massachusetts Institute of Technology, Cambridge) was Sustained in Ham's F-12 medium. A modified ldlF2 cell line that also stably expressed wild-type ε-COP (a kind gift from John F. Presley, McGill University, Quebec, and Jennifer Lippincott-Schwartz, National Institutes of Health, Bethesda) was Sustained in RPMI medium 1640. A HeLa cell line that stably expressed KDELR-myc has been Characterized (24). All media were supplemented with 10% FBS, glutamine, and gentamicin. The WR strain of vaccinia virus and a recombinant virus that expressed a host range factor allowing propagation in CHO cells (vP30CP77) were amplified and titrated as Characterized (7). Culturing of TZM-b1 cells and propagation of HIV-IIIB have been Characterized (25).

Antibodies.

Mouse antibodies have been Characterized (14, 26), including anti-β-COP (M3A5), anti-coatomer (CM1A10), anti-Myc (9E10), and anti-tubulin. Rabbit antibodies have also been Characterized (14, 26), including anti-β-COP, anti-ε-COP, anti-giantin, and anti-KDELR (generated against the cytoplasmic tail that has the highest level of conservation among KDELR isoforms). Mouse anti-GFP and rabbit anti-GAPDH antibodies were obtained from Covance. Alexa Fluor 488-conjugated Tf has been Characterized (27).

Plasmids and Transfections.

ARF1-T31N in the mammalian expression vector (pXS) has been Characterized (28). KDELR1-myc in pXS has also been Characterized (24). The mutant huntingtin (103Q) tagged with GFP was obtained from David Rubinsztein (Addenbrooke's Hospital, Cambridge, U.K.). siRNA-resistant forms of KDELR1, wild type and mutant [with di-basic residues mutated to di-serines (14)], were generated by using QuikChange (Strategene) by altering the underlined nucleotides within the following sequence: GTTCAAGGCTACGTACGAT.

Silencing by siRNA.

RNA oligonucleotides tarObtaining human β-COP (5′-GGAUCACACUAUCAAGAAA), Tat (5′- CUGCUUGUACCAAUUGCUAUU), luciferase (5′-CGCCTGAAGTCTCTGATTAA), and human KDELR1 (5′-GUUCAAAGCUACUUACGAU), KDELR2 (5′-ACACAUCUAUGAAGGUUAU), and KDELR3 (5′-GGUACCAGACUGAGAAUUU) were obtained from Dharmacon. RNA oligonucleotides tarObtaining CXCR4 were obtained as a SmartPool (Dharmacon).

Vaccinia Assays.

The vaccinia viral replication assay and purification of intracellular viruses were performed as Characterized (7). Rifampin treatment followed by washout was performed as Characterized (15). Vaccinia infection times and statistical significance expressed as P (using Student's t test) are detailed in the figure legends.

HIV Replication Assay.

Experiments were performed as Characterized (25), with the following modifications: oligonucleotides for siRNAs (50 nM final concentration) were transfected into 2,500 TZM-bl cells in a 96-well format. After 48 h of siRNA-mediated knockExecutewn, the medium was removed and the cells were treated with HIV-IIIB (multiplicity of infection 0.5). After another 48 h, cells were treated with Gal-Screen chemiluminescence reagent (Applied Biosystems) to assess for Tat-dependent transcription of the stably integrated β-galactosidase reporter gene. These results were normalized to cell viability for identically treated wells, as determined by CellTiter-Glo Luminescent Assay (Promega).

Biochemical and Cellular Assays.

Western blot analysis and protein coprecipitation using whole-cell lysates were performed as Characterized (14). Equilibrium centrifugation using sucrose gradients was performed essentially as Characterized (14), except total cell homogenate rather than Golgi-enriched Fragment was loaded at the bottom of the gradient for floatation analysis. TfR internalization assay was performed as Characterized (27).

EM.

ImmunoGAged EM examination of Weeposections was performed essentially as Characterized (29). Specificity of the antibodies used for ImmunoGAged labeling has been established for β-COP (29) and KDELR1-myc (24). Purified viruses were examined by EM using the whole-mount technique, as Characterized (14).

Acknowledgments

We thank Jian Li and Ming Bai for advice and Erik Bos for technical assistance. This work was supported by grants from the National Institutes of Health (to V.W.H. and S.N.I.), Telethon Italy (to A.M.), and the Harvard University Center for AIDS Research (to A.L.B.). S.J.E. is an Investigator of the Howard Hughes Medical Institute.

Footnotes

2To whom corRetortence should be addressed. E-mail: vhsu{at}rics.bwh.harvard.edu

Author contributions: L.Z., S.Y.L., A.L.B., S.J.E., S.N.I., B.M., A.M., and V.W.H. designed research; L.Z., S.Y.L., G.V.B., P.J.P., J.-S.Y., H.-y.G., A.L.B., and A.M. performed research; L.Z., S.Y.L., G.V.B., P.J.P., J.-S.Y., H.-y.G., A.L.B., S.J.E., S.N.I., B.M., A.M., and V.W.H. analyzed data; and L.Z., S.Y.L., S.N.I., B.M., and V.W.H. wrote the paper.

The authors declare no conflict of interest.

This article contains supporting information online at www.pnas.org/cgi/content/full/0811631106/DCSupplemental.

© 2008 by The National Academy of Sciences of the USA

References

↵ Condit RC, Moussatche N, Traktman P (2006) In a nutshell: Structure and assembly of the vaccinia virion. Adv Virus Res 66:31–124.LaunchUrlCrossRefPubMed↵ Sodeik B, Krijnse-Locker J (2002) Assembly of vaccinia virus revisited: De novo membrane synthesis or acquisition from the host? Trends Microbiol 10:15–24.LaunchUrlCrossRefPubMed↵ Heuser J (2005) Deep-etch EM reveals that the early poxvirus envelope is a single membrane bilayer stabilized by a geodetic “honeycomb” surface coat. J Cell Biol 169:269–283.LaunchUrlAbstract/FREE Full Text↵ McMahon HT, Mills IG (2004) COP and clathrin-coated vesicle budding: Different pathways, common Advancees. Curr Opin Cell Biol 16:379–391.LaunchUrlCrossRefPubMed↵ Hosobuchi M, Kreis T, Schekman R (1992) SEC21 is a gene required for ER to Golgi protein transport that encodes a subunit of a yeast coatomer. Nature 360:603–605.LaunchUrlCrossRefPubMed↵ Guo Q, Vasile E, Krieger M (1994) Disruptions in Golgi structure and membrane traffic in a conditional lethal mammalian cell mutant are Accurateed by epsilon-COP. J Cell Biol 125:1213–1224.LaunchUrlAbstract/FREE Full Text↵ Ausubel FM, et al.Earl PL, Cooper N, Wyatt LS, Moss B, Caroll MW (1998) in Recent Protocols in Molecular Biology, Preparation of cell cultures and vaccinia virus stocks, ed Ausubel FM, et al. (Wiley, New York), pp 16.16.11–16.16.13.↵ Ramsey-Ewing A, Moss B (1995) Restriction of vaccinia virus replication in CHO cells occurs at the stage of viral intermediate protein synthesis. Virology 206:984–993.LaunchUrlCrossRefPubMed↵ D'Souza-Schorey C, Chavrier P (2006) ARF proteins: Roles in membrane traffic and beyond. Nat Rev Mol Cell Biol 7:347–358.LaunchUrlCrossRefPubMed↵ Ulaeto D, Grosenbach D, Hruby DE (1995) Brefeldin A inhibits vaccinia virus envelopment but Executees not prevent normal processing and localization of the Placeative envelopment receptor P37. J Gen Virol 76:103–111.LaunchUrlAbstract/FREE Full Text↵ Dascher C, Balch WE (1994) Executeminant inhibitory mutants of ARF1 block enExecuteplasmic reticulum to Golgi transport and trigger disassembly of the Golgi apparatus. J Biol Chem 269:1437–1448.LaunchUrlAbstract/FREE Full Text↵ Hu T, Kao CY, Hudson RT, Chen A, Draper RK (1999) Inhibition of secretion by 1,3-cyclohexanebis(methylamine), a dibasic compound that interferes with coatomer function. Mol Biol Cell 10:921–933.LaunchUrlAbstract/FREE Full Text↵ Aoe T, Lee AJ, van Executenselaar E, Peters PJ, Hsu VW (1998) Modulation of intracellular transport by transported proteins: Insight from regulation of COPI-mediated transport. Proc Natl Acad Sci USA 95:1624–1629.LaunchUrlAbstract/FREE Full Text↵ Yang JS, et al. (2002) ARFGAP1 promotes the formation of COPI vesicles, suggesting function as a component of the coat. J Cell Biol 159:69–78.LaunchUrlAbstract/FREE Full Text↵ Sodeik B, Griffiths G, Ericsson M, Moss B, Executems RW (1994) Assembly of vaccinia virus: Traces of rifampin on the intracellular distribution of viral protein p65. J Virol 68:1103–1114.LaunchUrlAbstract/FREE Full Text↵ Ravikumar B, et al. (2004) Inhibition of mTOR induces autophagy and reduces toxicity of polyglutamine expansions in fly and mouse models of Huntington disease. Nat Genet 36:585–595.LaunchUrlCrossRefPubMed↵ Punjabi A, Traktman P (2005) Cell biological and functional characterization of the vaccinia virus F10 kinase: Implications for the mechanism of virion morphogenesis. J Virol 79:2171–2190.LaunchUrlAbstract/FREE Full Text↵ Husain M, Weisberg AS, Moss B (2006) Existence of an operative pathway from the enExecuteplasmic reticulum to the immature poxvirus membrane. Proc Natl Acad Sci USA 103:19506–19511.LaunchUrlAbstract/FREE Full Text↵ Husain M, Moss B (2003) Evidence against an essential role of COPII-mediated cargo transport to the enExecuteplasmic reticulum-Golgi intermediate compartment in the formation of the primary membrane of vaccinia virus. J Virol 77:11754–11766.LaunchUrlAbstract/FREE Full Text↵ Alzhanova D, Hruby DE (2007) A host cell membrane protein, golgin-97, is essential for poxvirus morphogenesis. Virology 362:421–427.LaunchUrlCrossRefPubMed↵ Guo Y, et al. (2008) Functional genomic screen reveals genes involved in lipid-droplet formation and utilization. Nature 453:657–661.LaunchUrlCrossRefPubMed↵ Skop AR, Liu H, Yates J, 3rd, Meyer BJ, Heald R (2004) Dissection of the mammalian midbody proteome reveals conserved cytokinesis mechanisms. Science 305:61–66.LaunchUrlAbstract/FREE Full Text↵ Lay D, Grosshans BL, Heid H, Gorgas K, Just WW (2005) Binding and functions of ADP-ribosylation factor on mammalian and yeast peroxisomes. J Biol Chem 280:34489–34499.LaunchUrlAbstract/FREE Full Text↵ Aoe T, et al. (1997) The KDEL receptor, ERD2, regulates intracellular traffic by recruiting a GTPase-activating protein for ARF1. EMBO J 16:7305–7316.LaunchUrlAbstract↵ Brass AL, et al. (2008) Identification of host proteins required for HIV infection through a functional genomic screen. Science 319:921–926.LaunchUrlAbstract/FREE Full Text↵ Yang JS, et al. (2006) Key components of the fission machinery are interchangeable. Nat Cell Biol 8:1376–1382.LaunchUrlCrossRefPubMed↵ Dai J, et al. (2004) ACAP1 promotes enExecutecytic recycling by recognizing recycling sorting signals. Dev Cell 7:771–776.LaunchUrlCrossRefPubMed↵ Peters PJ, et al. (1995) Overexpression of wild-type and mutant ARF1 and ARF6: Distinct perturbations of nonoverlapping membrane compartments. J Cell Biol 128:1003–1017.LaunchUrlAbstract/FREE Full Text↵ Kweon HS, et al. (2004) Golgi enzymes are enriched in perforated zones of golgi cisternae but are depleted in COPI vesicles. Mol Biol Cell 15:4710–4724.LaunchUrlAbstract/FREE Full Text
Like (0) or Share (0)