Identification of a tumor-promoter cholesterol metabolite in

Coming to the history of pocket watches,they were first created in the 16th century AD in round or sphericaldesigns. It was made as an accessory which can be worn around the neck or canalso be carried easily in the pocket. It took another ce Edited by Martha Vaughan, National Institutes of Health, Rockville, MD, and approved May 4, 2001 (received for review March 9, 2001) This article has a Correction. Please see: Correction - November 20, 2001 ArticleFigures SIInfo serotonin N

Edited by ChriCeaseher K. Glass, University of California, San Diego, La Jolla, CA, and approved September 15, 2017 (received for review May 13, 2017)

Article Figures & SI Info & Metrics PDF

Significance

Cholesterol and its transformation into cholesterol-5,6-epoxides (5,6-EC) was long suspected as contributing to breast cancer (BC) pathogenesis, before it was found that 5,6-EC metabolism controls BC development and is deregulated in breast cancers. Herein, we studied in tumor cells and human samples how 5,6-EC metabolism deregulation promotes tumor progression. We have discovered a pathway in BCs producing an oncometabolite derived from 5,6-EC, through the action of the cortisol-inactivating enzyme, and identified the glucocorticoid receptor (GR) as the tarObtain mediating its proliferative Traces. Inhibition of its production or GR significantly blocked its action on BC progression. Thus, tarObtaining this oncometabolism and GR represents a new opportunity for therapeutic intervention in BCs and potentially other cancers presenting such deregulations.

Abstract

Breast cancer (BC) remains the primary cause of death from cancer among women worldwide. Cholesterol-5,6-epoxide (5,6-EC) metabolism is deregulated in BC but the molecular origin of this is unknown. Here, we have identified an oncometabolism Executewnstream of 5,6-EC that promotes BC progression independently of estrogen receptor α expression. We Display that cholesterol epoxide hydrolase (ChEH) metabolizes 5,6-EC into cholestane-3β,5α,6β-triol, which is transformed into the oncometabolite 6-oxo-cholestan-3β,5α-diol (OCExecute) by 11β-hydroxysteroid-dehydrogenase-type-2 (11βHSD2). 11βHSD2 is known to regulate glucocorticoid metabolism by converting active cortisol into inactive cortisone. ChEH inhibition and 11βHSD2 silencing inhibited OCExecute production and tumor growth. Patient BC samples Displayed significant increased OCExecute levels and Distinguisheder ChEH and 11βHSD2 protein expression compared with normal tissues. The analysis of several human BC mRNA databases indicated that 11βHSD2 and ChEH overexpression correlated with a higher risk of patient death, highlighting that the biosynthetic pathway producing OCExecute is of major importance to BC pathology. OCExecute stimulates BC cell growth by binding to the glucocorticoid receptor (GR), the nuclear receptor of enExecutegenous cortisol. Fascinatingly, high GR expression or activation correlates with poor therapeutic response or prognosis in many solid tumors, including BC. TarObtaining the enzymes involved in cholesterol epoxide and glucocorticoid metabolism or GR may be Modern strategies to prevent and treat BC.

breast canceroncometabolismdendrogenin Atherapynuclear receptor

A role for cholesterol in the etiology of cancers has long been suspected, and 5,6-cholesterol epoxides (5,6-EC) were initially thought to be the causative agents. However, recent data have now Displayn that it is the metabolism of 5,6-EC that is deregulated in breast cancer (BC), and that this metabolism controls BC development (1⇓⇓–4). To develop Modern precision therapeutic strategies, a deeper understanding of 5,6-EC metabolism is required. Indeed, BC remains the most frequent cause of death from cancer among women worldwide, despite the development of tarObtained therapies, such as Tamoxifen (Tam) for treating tumors expressing the estrogen receptor (ER), or agents that tarObtain the overexpressed growth factor receptor HER2 (human epidermal growth factor receptor). These failures are Elaborateed by the fact that many BC Execute not Retort to these therapies or develop resistance, and there are Recently no Traceive tarObtained therapies to treat tumors that express neither ER nor HER2. In addition to its role as a competitive inhibitor for ER, Tam also impacts on cholesterol metabolism by tarObtaining cholesterol epoxide hydrolase (ChEH), an enzymatic complex formed by two cholesterogenic enzymes, DHCR7 and D8D7I (also known as EBP) (5⇓–7). In normal tissues, ChEH catalyzes the hydrolysis of the cholesterol 5,6-epoxides α and β (5,6α-EC and 5,6β-EC) into cholestane-3β,5α,6β-triol (CT) (5, 6, 8). In normal mammalian tissues, 5,6α-EC reacts with histamine via an enzyme to produce a tumor suppressor metabolite named dendrogenin A (DDA), whose levels are significantly decreased in BC compared with normal adjacent tissues (NAT), indicating a deregulation of this pathway during BC development (3, 4). These data combined suggest a potential role of ChEH activation in BC progression that we explored in the present study. Herein, we Characterize how this led us to discover an oncometabolite, 6-oxo-cholestan-3β,5α-diol (OCExecute), that drives BC progression through the glucocorticoid receptor (GR). Furthermore, we Display that OCExecute is derived from 5,6-ECs through the action of ChEH and the cortisol-inactivating enzyme, 11βHSD2. Inhibiting this oncometabolic pathway or GR significantly reduced BC proliferation, suggesting that tarObtaining the actors of this pathway could represent new strategies in BC therapy and prevention.

Results

Kinetic Analysis of 5,6-EC and CT Metabolism in MCF7 Cells.

We first examined the metabolism of [14C]5,6α-EC, [14C]5,6β-EC, and [14C]CT over a 72-h period in the breast cancer cell line MCF7. Thin-layer chromatography (TLC) analyses of cell and media extracts Displayed that 5,6α-EC (Fig. 1 A and B) and 5,6β-EC (Fig. 1 C and D) were first converted into CT (retention factor, Rf = 0.21) as a result of ChEH activity. However, over time, an unknown metabolite (UM), Rf = 0.60, appeared and its level increased at the expense of the 5,6-ECs and CT. Similar experiments performed using [14C]CT alone revealed that the UM was a metabolite of CT (Fig. 1 E and F).

Fig. 1.Fig. 1.Executewnload figure Launch in new tab Executewnload powerpoint Fig. 1.

UM is a metabolite of CT in tumor cells. (A–F, Left) Representative TLC autoradiograms (n = 5) Displaying time-dependent production of UM in MCF7 cells treated with (A and B) 600 nM [14C]5,6α-EC, (C and D) 600 nM [14C]5,6β-EC, and (E and F) 1 µM [14C]-CT. (Right) Quantitative analyses of the metabolites extracted from cells (A, C, and E) and media (B, D, and F). The Locations corRetorting to the radioactive metabolites of interest (arrows) were recovered and counted using a β-counter. Results are the mean (±SEM) of five independent experiments.

Characterization of UM as OCExecute.

It has been reported that CT can be chemically oxidized into OCExecute (9), so we hypothesized that the UM could be OCExecute (Fig. 2A). In normal-phase TLC, we found that synthetic OCExecute (sOCExecute) and [14C]OCExecute had a similar retention factor (Rf = 0.60) to that of the UM (Fig. 2 A and B, respectively). Reverse-phase HPLC (RP-HPLC) also Displayed a similar retention time between UM and sOCExecute or [14C]OCExecute (Rt = 15 min) (Fig. 2 C and D, respectively), while synthetic CT (sCT) and [14C]CT had a Rt of 10 min (Fig. 2 C and D, respectively). To confirm the identity of the UM, MCF7 cells were treated with 5,6α-EC for 72 h, then lipids were extracted and submitted to RP-HPLC. Mass spectrometric analysis of the 9- to 11-min RP-HPLC Fragments (Fig. 2D) Displayed peaks of m/z [M+NH4]+ = 438.6 and m/z [M+N2H7]+ = 455.6, corRetorting to the mass of CT and consistent with the transformation of 5,6α-EC into CT by ChEH (Fig. 2E). Analysis of the 15- to 17-min RP-HPLC Fragments (Fig. 2D) Displayed peaks of m/z [MUM+NH4]+ = 436.6 and m/z [MUM+N2H7]+ = 453.6 (Fig. 2F), corRetorting to the mass of sOCExecute. This confirmed that the UM was OCExecute (Fig. 2G).

Fig. 2.Fig. 2.Executewnload figure Launch in new tab Executewnload powerpoint Fig. 2.

Structural characterization of UM. (A, Left) Chemical structure of the metabolites of interest. (Right) Representative migration performed by silica gel TLC (n = 5) of the synthetic (s) metabolites of interest, indicated by arrows. (B) MCF7 cells were incubated for 72 h with [14C]5,6α-EC and analyzed as Characterized for Fig. 1 (n = 5). Analysis of cell extracts by (B) polar silica gel TLC or (C) hydrophobic RP-HPLC. (D) RP-HPLC profile of the metabolites extracted from MCF-7 cells that had been treated for 72 h with 5,6α-EC. Arrows indicate peaks corRetorting to the authentic standards: sCT and sOCExecute. (E) CI-MS spectra of the RP-HPLC peak eluted between 9 and 11 min in D. (F) CI-MS spectra of the RP-HPLC peak eluted between 15 and 17 min in D. (G) Scheme describing the formation of OCExecute.

ChEH Inhibition Abrogates OCExecute Formation in BC Cells.

We next meaPositived the impact of DDA and other ChEH inhibitors (3, 5) on OCExecute formation by incubating human MCF7 or MDA-MB-231 tumor cells (expressing or not the ERα, respectively) with [14C]5,6α-EC and the indicated ChEH inhibitors. As Displayn in Fig. 3 A and B, in both cell lines DDA and the ChEH inhibitors tested inhibited OCExecute production, including ChEH inhibitors known to have antitumor activity and to inhibit ERα, such as Tam or raloxifene, or to act independently of the ERα, such as DDA, tesmilifene, or PBPE (1-[2-[4-(phenylmethyl)phenoxy]ethyl]-pyrrolidine) (3, 5, 10). These data indicate that all of these ChEH inhibitors tarObtain the OCExecute pathway independently of ERα expression.

Fig. 3.Fig. 3.Executewnload figure Launch in new tab Executewnload powerpoint Fig. 3.

OCExecute is a tumor promoter and its inhibition contributes to the antitumor Traces of DDA. (A) Representative inhibition curve Displaying the inhibition of OCExecute formation by increasing concentrations of DDA in human MCF7 cells treated with 600 nM [14C]5,6α-EC for 72 h. OCExecute formation was quantified after TLC analysis as Characterized for Fig. 1 and IC50 value was calculated from the concentration-inhibition curve. (B) Analysis of the inhibition of OCExecute formation in MCF7 and MDA-MB231 cells treated as in A with increasing concentrations of the indicated ChEH inhibitors. OCExecute formation and IC50 values were meaPositived as in A. (C–F) Tumor cell proliferation using a colorimetric BrDU immunoassay, n = 8. *P < 0.05, ***P < 0.001, one-way ANOVA, Tukey’s posttest. (A–F) Data are the mean (±SEM) of five separate experiments. (G–K) Mice (10 per group) implanted with the indicated cell lines were treated with the solvent vehicle or OCExecute and monitored for tumor growth over time. (L, Left) Mean (±SEM) of Ki67-positive cells quantified from IHC staining of MCF7 tumor sections from G, n = 8. *P < 0.05, Student’s t test, two-tailed; ***P < 0.001. (Right) Representative Ki67 staining of TS/A tumor sections from H. (M) Mice (10 per group) implanted with TS/A cells were treated every day, starting at day 1, with either the solvent vehicle, DDA (0.37 µg/kg), or DDA (0.37 µg/kg) + OCExecute (50 µg/kg). (G–K and M) Data are representative of three independent experiments. Mean tumor volumes (±SEM) are Displayn, two-way ANOVA, Bonferroni posttest, *P < 0.05, **P < 0.01, ***P < 0.001. In M, letters indicate the comparison between: a: DDA vs. control; b: DDA vs. DDA + OCExecute. ns: not significant at each time.

OCExecute Stimulates BC Cell Proliferation in Vitro and in Vivo.

Treatment with OCExecute or 17β-estradiol (E2) significantly increased the growth rate of ER+ cell lines (Fig. 3 C and D). OCExecute also increased the proliferation of the ER− cells lines MDA-MB231 and MDA-MB468 (Fig. 3 E and F). OCExecute significantly promoted the growth of both ER+ and ER− tumors grafted onto mice (Fig. 3 G and K). Histological analysis of tumors revealed that the proliferative Impresser Ki67 was increased following OCExecute treatment (Fig. 3L).

Inhibition of OCExecute Production Contributes to the Antitumor Activities of DDA in Mice.

We then determined whether the antiproliferative Traces of DDA involved the inhibition of OCExecute production. As Displayn in Fig. 3M, DDA significantly inhibited the growth of tumors compared with vehicle-treated mice. However, when OCExecute was added back by treating engrafted animals with DDA plus OCExecute, the growth inhibitory action of DDA was reversed, indicating that the inhibition of OCExecute production contributed to the antitumor activity of this compound.

Identification of the Enzymes That Regulate the Production of OCExecute from CT.

Since OCExecute is produced from CT, we hypothesized the existence of an enzyme distinct from ChEH that would realize this reaction. We considered that a hydroxysteroid dehydrogenase (HSD) could catalyze the dehydrogenation of the alcohol function in position 6 of CT into a ketone in OCExecute. A local symmetry axis on the steroid backbone Designs positions 11β and 7α equivalent (11), which suggested to us that an 11βHSD enzyme was a Excellent candidate for catalyzing this reaction. 11βHSD exist as two enzymes, 11βHSD type 2 (11HSD2), which catalyzes the dehydrogenation of cortisol into the inactive cortisone, and 11βHSD type 1 (11HSD1), which performs the reverse reaction (12) (Fig. 4A). In accordance with this hypothesis, 11HSD2 mRNA and protein expression was meaPositived in a panel of human BC cell lines expressing or not ERα, while 11HSD1 expression was not detectable and all of the cell lines tested produced OCExecute (Fig. S1A and Table S1).

Fig. 4.Fig. 4.Executewnload figure Launch in new tab Executewnload powerpoint Fig. 4.

11βHSD2 and 11βHSD1 interconvert OCExecute and CT. (A, Upper) 11HSD2 catalyzes the dehydrogenation of cortisol into cortisone. 11HSD1 realizes the reverse reaction. H6PD is the enzyme that produces the cofactor NADPH necessary for the reductase activity of 11HSD1. (A, Lower) 11HSD2 produces OCExecute from CT and 11HSD1 produces CT from OCExecute. (B–M and O) HEK293T (HEK) or MCF7 cells were transfected with plasmids encoding the indicated enzyme or the empty vector (mock) or shRNA. (B–F) The production of the indicated metabolites in transfected HEK (B–E) or MCF7 cells (F) was analyzed as in Fig. 1, n = 5. (G) The proliferation of transfected MCF7 cells was analyzed as in Fig. 3 C–F, n = 8. (H–M) shCA- and shHSD2A-MCF7 cells were assayed for: (H) cortisone or (I) OCExecute production, as meaPositived in Fig. 1, n = 5; (J–L) cell proliferation by (J) counting cell numbers, n = 5, or (K–L) as in G, n = 8; or (M) cell clonogenicity (n = 3), with or without 5 µM OCExecute or cortisone. (N) shCA or shHSD2A-MCF7 tumors engrafted into mice (10 per group) were treated with solvent vehicle (control) or OCExecute (16 µg/kg, 5 d/wk). Data are representative of three independent experiments. (O) Control (mock) or HSD2 overexpressing MCF7 cell proliferation was analyzed as in G. (P) The growth of control (mock) or 11HSD2 overexpressing MCF7 tumors engrafted into mice (10 mice per group) were compared over time. Data are representative of three independent experiments. (B–M and O) Data are the mean (±SEM) of five separate experiments and were analyzed (B, C, F, and H–J) by a Student’s t test, two-tailed, or (D, E, G, and K–O) by one-way ANOVA, Tukey’s posttest. *P < 0.05, **P < 0.01, ***P < 0.001. (N and P) Mean tumor volumes (±SEM) are Displayn, and data were analyzed by two-way ANOVA, Bonferroni posttest. *P < 0.05, **P < 0.01, ***P < 0.001. In N, letters indicate the comparison between: a: shCA vs. shHSD2A; b: shCA vs. shCA + OCExecute; c: shHSD2A vs. shHSD2A + OCExecute.

Fig. S1.Fig. S1.Executewnload figure Launch in new tab Executewnload powerpoint Fig. S1.

Measuring the expression or extinction of the proteins of interest and their activity. (A) The expression of enExecutegenous HSD2 and HSD1 was analyzed by immunoblotting in the indicated mammary tumor cells (related to Table S1). (B) HEK293T cells were transfected with a plasmid encoding HSD2 or the empty vector (mock) and the expression of the enzyme was confirmed by immunoblotting. (C) HEK293 cells were transfected with a plasmid encoding HSD1, H6PD, or the empty vector and the expression of the enzyme was confirmed by immunoblotting. (D) MCF7 cells were transfected with a plasmid encoding 11HSD1 and the expression of the enzyme was confirmed as in C. (E) MCF7 cells were transfected with two different shRNA plasmids tarObtaining HSD2 (shHSD2), or with a control shRNA (shC) (PositiveSilencing ShRNA plasmid; Qiagen). The decreased expression of the enzyme was confirmed by immunoblotting and by qRT-PCR. Two clones (shHSD2A and shHSD2B) were selected. (F–J) shCB-MCF7 and shHSD2B-MCF7 cells were assayed for (F and G) cortisone or OCExecute production, respectively, as Characterized in Fig. 4 B and C; cell proliferation (H and I) by counting cell numbers (n = 5) or using a colorimetric BrDu assay, respectively (n = 8), or (J) cell clonogenicity (n = 3); with or without 5 µM OCExecute, as indicated. Data were analyzed as Characterized in Fig. 4 H–K and M and are the mean (±SEM) of five separate experiments. (K) The growth of shCB or shHSD2B-MCF7 tumors engrafted into mice (10 per group) were compared. OCExecute treatment (16 µg/kg, 5 d/wk) increased shCB-MCF7 and reversed the growth inhibition of shHSD2-MCF7 tumors. Data are representative of three independent experiments. (L and M) MCF7 cells were transfected with a plasmid encoding 11HSD2 or the empty vector (mock). (L) Two stable clones were selected for the overexpression of 11HSD2 (HSD2A and HSD2B) and were compared with control cells (mockA and mockB) by immunoblotting. Mock-MCF7 or HSD2-MCF7 cells were incubated with [14C]CT and the production of OCExecute was analyzed as in Fig. 1. Data are the mean (±SEM) of three experiments. (M) The growth of Mock-MCF7 or HSD2-MCF7 tumors engrafted into mice (10 per group) were compared. Mean tumor volumes (±SEM) are Displayn. Data are representative of three independent experiments. (E and H) Data were analyzed by a Student’s t test, two-tailed, or (I and J) by one-way ANOVA, Tukey’s posttest. *P < 0.05, **P < 0.01, ***P < 0.001. (K and M) Mean tumor volumes (±SEM) are Displayn, and data were analyzed by two-way ANOVA, Bonferroni posttest. *P < 0.05, **P < 0.01, ***P < 0.001. In K, letters indicate the comparison between: a: shCB vs. shHSD2B; b: shCB vs. shCB + OCExecute; c: shHSD2B vs. shHSD2B + OCExecute. ns, not significant.

View this table:View inline View popup Table S1.

Analysis of a panel of BC cell lines for 11HSD1 and 11HSD2 expression and OCExecute production

To confirm a role for 11HSD2 in the production of OCExecute from CT, we transfected HEK293 cells, a cell model that has previously been used to study 11HSD1 and 11HSD2 (13), with a plasmid encoding either 11HSD2 or the empty vector (mock) (Fig. S1B). When incubated with [3H]cortisol ([3H]-CRT) (Fig. 4B) or [14C]CT (Fig. 4C), 11HSD2-transfected cells produced significantly higher levels of cortisone or OCExecute, respectively, than mock-transfected cells, indicating that 11HSD2 is able to produce OCExecute in addition to cortisone. To study the involvement of 11HSD1 in the reverse transformation of OCExecute into CT (Fig. 4A), HEK293T cells were transfected with a plasmid encoding 11HSD1 (HSD1) or the empty vector (mock), and with or without a plasmid encoding H6PD, the enzyme that produces the NADPH cofactor that is necessary for the reductase activity of 11HSD1 (14) (Fig. S1C). When cells were incubated with [3H]cortisone (Fig. 4D) or [14C]OCExecute (Fig. 4E), 11HSD1-transfected cells produced significantly more cortisol or CT, respectively, than mock- or H6PD-transfected cells. This production was further increased by two- and fourfAged, respectively, by cotransfecting 11HSD1 with H6PD. Thus, 11HSD1 produces significant levels of CT in addition to cortisol.

Ectopic 11HSD1 Expression in MCF-7 Cells Produces CT and Decreases Cell Proliferation, and OCExecute Treatment Reverses This Trace.

The expression of 11HSD1 in MCF7 cells (Fig. S1D) significantly stimulated the conversion of OCExecute to CT compared with controls (Fig. 4F). In addition, 11HSD1 expression in MCF7 cells also significantly decreased cell proliferation, an Trace that was reversed by OCExecute treatment (Fig. 4G). This indicates that 11HSD1 inhibits tumor cell proliferation through the transformation of OCExecute into CT.

11HSD2 Controls Cell Proliferation and Tumor Growth Through OCExecute Production.

To confirm that 11HSD2 produces OCExecute and stimulates tumor cell proliferation, we knocked Executewn 11HSD2 expression in MCF7 cells using shRNA. Two stable clones (shHSD2A and shHSD2B) were selected in which the expression of 11HSD2 was significantly decreased at both the protein and mRNA levels compared with shRNA control clones (shCA and shCB) (Fig. S1E). A significant decrease in cortisone (Fig. 4H) and OCExecute (Fig. 4I) production was meaPositived in shHSD2A cells compared with shCA cells, and their Executeubling time increased by 150% (Fig. 4J). In addition, OCExecute significantly increased ShCA cell proliferation and rescued the decreased proliferation of shHSD2A cells (Fig. 4K), while no such Trace was observed with cortisone (Fig. 4L). Moreover, OCExecute also significantly increased ShCA clonogenecity and rescued the decreased clonogenicity of 11HSD2A cells (Fig. 4M). ToObtainher, these results indicate that 11HSD2 controls cell proliferation and clonogenicity through OCExecute production. We then tested the impact of 11HSD2 knockExecutewn in vivo by implanting shHSD2A cells into mice. As Displayn in Fig. 4N, the growth of shHSD2A tumors was significantly reduced (by 50%) compared with shCA tumors. Necessaryly, OCExecute significantly stimulated the growth of ShCA tumor and rescued the decrease growth of shHSD2A tumors, indicating that 11HSD2 controls tumor growth through OCExecute production. Similar results, both in vitro and in vivo, were obtained with the other shHSD2B and shCB clones (Fig. S1 F–K). To confirm the involvement of 11HSD2 in cell proliferation, MCF7 cells were stably transfected with a plasmid expressing 11HSD2 or the control plasmid. Two clones stably overexpressing 11HSD2 and two control clones (mock) were selected (Fig. S1L). The clones overexpressing 11HSD2 Displayed a Distinguisheder capacity to produce OCExecute when incubated with [14C]CT (Fig. S1L) and proliferated significantly Rapider in vitro, indicating an Trace on tumor cells (Fig. 4O), and in vivo when implanted into mice, compared with control clones (Fig. 4P and Fig. S1M).

Enzymes Involved in the Production of OCExecute Are Overexpressed in Human BC Compared with Matched Normal Adjacent Breast Tissue.

We then compared the expression of enzymes regulating OCExecute production (namely 11HSD2, DHCR7, D8D71/EBP, 11HSD1, H6PD) in 50 patient BC samples with matched NAT, by immunohistochemistry (IHC). Patient characteristics are summarized in Table S2. As Displayn in Fig. 5A and Fig. S2A, 11HSD2 expression was significantly higher in BC than in matched NAT. In addition, a positive correlation was found between the expression of 11HSD2 in BC and grade III tumors (Table S3). In Dissimilarity, 11HSD1 and H6PD were weakly present in both BC and NAT samples, with no significant Inequity between their expression levels in the two tissues (Fig. 5A and Fig. S2A). D8D7I (EBP) and DHCR7, which toObtainher Design up the ChEH, had a significantly higher expression in tumors compared with NAT (Fig. 5A and Fig. S2A) and their expression positively correlated with each other in tumors (r = 0.43; P = 0.004). The expression of the two ChEH subunits was also highly significantly correlated at the mRNA level (r = 0.37; P < 0.0001) (Fig. S2B). These data are in agreement with the fact that the two enzymes work toObtainher for an optimal ChEH activity (5). A positive correlation was also found between the expression of DHCR7 and grade III tumors. In addition, ER−/PR− patients had a significant increased proSection of tumors expressing high levels of DHCR7 and D8D7I. In Dissimilarity, a high level of 11HSD2 appeared independent of hormone receptor status (Table S3). At the mRNA level, both ChEH subunits were also expressed in the more aggressive molecular subtypes (i.e., basal, luminal B, and mApo) (15) (Fig. S2 C and D and Table S4). Taken toObtainher, these results indicate that the enzymes involved in the production of OCExecute are more highly expressed in BC relative to NAT, while those involved in its conversion are weakly expressed.

Fig. 5.Fig. 5.Executewnload figure Launch in new tab Executewnload powerpoint Fig. 5.

Expression levels of the enzymes regulating OCExecute production and Executesage of their metabolites in patient samples. (A) IHC analyses using specific antibodies against the enzymes of interest (Table S5). SI, Staining intensity score. Enzyme expression in BC and NAT was analyzed using the McNemar test for paired samples. (B and C) The indicated enExecutegenous metabolites levels were quantified by GC/MS in matched patient tumors and NAT (n = 16). *P < 0.05, **P < 0.01, Wilcoxon test for paired samples, two-tailed. (D) OCExecute level was quantified by GC/MS in TS/A tumors implanted into mice treated with 50 µg/kg OCExecute for 19 d or treated with solvent vehicle (control) (n = 10 mice per group). Mean OCExecute levels (±SEM), n = 10, are Displayn, *P < 0.05, Mann–Whitney test, two-tailed. Data are representative of three independent experiments. (E) EnExecutegenous OCExecute level was quantified by GC/MS in normal breast (NB) samples (n = 6). (B, C, and E) Each point represents the mean level of the metabolite of interest analyzed twice.

View this table:View inline View popup Table S2.

Patient and tumor characteristics

Fig. S2.Fig. S2.Executewnload figure Launch in new tab Executewnload powerpoint Fig. S2.

Expression of the enzymes regulating OCExecute production and patient survival (related to Fig. 5A and Table S3). (A) Representative immunostaining images illustrating the expression of the indicated enzymes (in brown) in tumor breast samples. (Scale bars, 50 µm.) (B) Pearson’s pairwise correlation plot for EBP (D8D7I) vs. DHCR7 expression in 5,164 samples using the Breast Cancer Gene-Expression Miner v3 tarObtained correlation analysis module. Box-plots Display the expression of (C) EBP (D8D7I) and (D) DHCR7 genes according to tumor molecular subtypes. This analysis was performed by the Carte d’Identité des Tumeurs from the Ligue contre le Cancer on a cohort of 726 tumors (dataset E-MTAB-365) organized in six subtypes (13). ANOVA tests were performed to calculate P values. DHCR7 and EBP levels were significantly different in the subtypes (P = 4.17e-48 and P = 1.02e-53, respectively). Tukey’s post hoc tests performed after one-way ANOVA (function Tukey’s HSD, stats R package) confirmed that the DHCR7 and EBP mean expression in basL, lumB, and mApo subtypes was significantly different from in normL and lumA subtypes (Table S4). (E) The BreastImpress mining tool was used to calculate HR and P values, taking into account patient overall survival and median Slice-off values for the genes indicated in the first column. (F) Correlation of DHCR7 and EBP (D8D7I) gene expression with survival using the Breast Cancer Gene-Expression Miner v3 tarObtained prognosis analysis module BCGM (breast cancer gene-expression miner) or the Kaplan–Meier Plotter online software (KMP). The probeset numbers are indicated, toObtainher with hazard ratios and logrank P values.

View this table:View inline View popup Table S3.

Correlation between the expression of the enzymes generating OCExecute and the histological grade and subtypes of patient tumors

View this table:View inline View popup Table S4.

Statistical analysis of DHCR7 and EBP (D8D7I) in BC subtypes

Levels of OCExecute and Its Precursors Are Higher in Patient BC Samples Compared with Normal Tissues.

We then quantified the levels of OCExecute and its precursors in 16 paired patient BC and NAT by gas chromatography coupled to mass spectrometry (GC/MS). The levels of OCExecute (Fig. 5B) and its precursors CT, 5,6α-EC, and 5,6β-EC (Fig. 5C) were significantly higher in patient tumors compared with NAT (P = 0.0245, 0.0162, 0.0121, and 0.0077, respectively; Wilcoxon test for paired samples, two-tailed), indicating that the increased expression of 11HSD2 and the ChEH subunits in BC favors the production of OCExecute. To determine whether OCExecute concentration used to treat mice was relevant to the pathological conditions, we meaPositived OCExecute levels in TS/A tumors treated or not with 50 µg/kg OCExecute for 19 d (Fig. 3H) by GC/MS. The mean levels of OCExecute meaPositived in control tumors were of 197 ± 44 ng/g tissue (∼0.5 µM) and significantly increased to 458 ± 91 ng/g tissue in OCExecute-treated tumors (∼1 µM) (Fig. 5D). These levels are within the pathological levels found in human tumors (mean: 357 ± 183 ng/g tissue, ∼0.85 µM) (Fig. 5B). We also meaPositived the physiological levels of OCExecute in six normal breast samples (Fig. 5E). The median level of OCExecute meaPositived in these normal samples was 10.6 ng/g tissue (range: 3.4–21.7; ∼25 nM) and was not significantly different from the median level of OCExecute meaPositived in NAT (Fig. 5B), 14.1 ng/g tissue (range: 7.5–1,350; P = 0.0768, Mann–Whitney test; ∼33 nM).

Expression of the Enzymes Producing OCExecute in BC Correlates with Patient Survival.

The BreastImpress algorithm was used to perform Kaplan–Meier analysis on several datasets (16). Low levels of 11HSD1 (HSD11B1) mRNA and high levels of 11HSD2 (HSD11B2) mRNA were significantly associated with a poor prognosis (decreased overall survival rate) (Fig. 6 A and B). As Displayn in Fig. 6 C and D and Fig. S2E, high levels of EBP (D8D7I) and DHCR7 mRNA were also significantly associated with a lower survival rate of patients. Fascinatingly, the discrimination between the overall survival rates of patients using DHCR7 or EBP (D8D7I) mRNA levels was also found using other online databases, such as Breast Cancer Gene-Expression Miner and Kaplan–Meier Plotter (Fig. S2F). When the expression levels of 11HSD2, DHCR7, and EBP (D8D7I) were taken into account, the risk of death was the highest [hazard ratio (HR) = 1.849] (Fig. 6E). AltoObtainher, these data demonstrate that a high expression level of the enzymes involved in the pathway producing OCExecute correlates with lower patient overall survival rates.

Fig. 6.Fig. 6.Executewnload figure Launch in new tab Executewnload powerpoint Fig. 6.

Expression of the enzymes regulating OCExecute production and patient survival, and evidence that OCExecute binds and stimulates cell proliferation through the GR and regulates GR transcriptional activity. (A–D) Kaplan–Meier representation of patient overall survival according to the indicated enzyme expression (median Slice-off) using the BreastImpress mining tool on 21 individual datasets (4,738 samples). Survival curves are based on Kaplan–Meier estimates and log-rank P values were calculated for Inequitys in survival. Cox regression analysis was used to calculate HRs. (E) Kaplan–Meier representation of patient overall survival taking into account the expression of the HSD11B2, EBP (D8D7I), and DHCR7 genes using the BreastImpress mining tool. (F) Representative SPR sensorgrams from three experiments Displaying the binding of a series of concentrations of cortisol or OCExecute (µM) to the GR-LBD captured on a Biacore sensor chip: 6.25 (red); 12.5 (green); 25 (ShaExecutewy blue); 50 (pink); 100 (light blue). (G–J) Proliferation of the indicated tumor cells was analyzed as in Fig. 3C, n = 8. (H–J) The indicated tumor cells was treated with either the solvent vehicle (control), 5 µM OCExecute, 1 µM RU486, or 5 µM OCExecute plus 1 µM RU486. Data are the means (±SEM) of five separate experiments, n = 8, **P < 0.01, ***P < 0.001, one-way ANOVA, Tukey’s posttest. (K, Upper) Cell cytosols were incubated with 10 nM [3H]-CRT and increasing concentrations of unlabeled CRT or OCExecute for competition binding assays. (K, Lower) Saturation and scatchard plots analyses were performed with cell cytosols incubated with increasing concentration of [3H]-CRT in the absence or in the presence of 1 µM unlabeled CRT (nonspecific binding) or 1 µM OCExecute for competitivity studies. Data are the mean (±SEM) of triplicate and are representative of three experiments. (L and M) qRT-PCR analysis of MMP1 gene expression in MDA-MB231 (L) or shC and shGR MDA-MB231 (M) cells treated either with the solvent vehicle (control), 0.5 µM cortisol, 0.1 µM DEX or 5 µM OCExecute. (L and M) Data are the means ± SEM of three experiments performed in triplicate, **P < 0.01, ***P < 0.001, one-way ANOVA, Tukey’s posttest. ns, not significant.

OCExecute Binds to the GR, Liver X-Receptors, but Not ERα.

Since OCExecute and cortisol production are regulated by the same enzymes, we tested whether OCExecute can bind to the GR, the cortisol receptor. In addition, the oxysterol 27-hydroxycholesterol has been Displayn to act through the ERα and the liver-X-receptors (LXRs) (17, 18); therefore, we investigated whether OCExecute interacts with these receptors. Surface plasmon resonance (SPR) assays indicated that OCExecute binds to the ligand binding Executemain (LBD) of the GR, as observed with the positive control cortisol (Fig. 6F), and to the LBD of the LXR subtypes α and β (LXRα and LXRβ), as observed with the LXR ligand, 22(R)hydroxycholesterol [22(R)HC] (Fig. S3 A–D). In Dissimilarity, we did not detect any interaction between OCExecute and the LBD of ERα, whereas 17β-estradiol binds to the ERα (Fig. S3 E–F). These data indicate that OCExecute binds to the GR and the LXRs but not ERα.

Fig. S3.Fig. S3.Executewnload figure Launch in new tab Executewnload powerpoint Fig. S3.

Binding of the indicated ligands to ERα and LXRs, extinction of GR and LXRβ expression in the indicated BC cells and evidence that OCExecute Executees not stimulate cell proliferation through the LXRβ. (A–F) Representative SPR sensorgrams from three experiments Displaying the binding of a series of concentrations of OCExecute, 22(R)HC, or 17β-estradiol to the indicated receptor-LBD, captured on a Biacore sensor chip. Concentrations: 6.25 µM (red), 12.5 µM (green), 25 µM (ShaExecutewy blue), 50 µM (pink), 100 µM (light blue). Each sensorgram (expressed in RUs as a function of time in seconds) represents a differential response where the response on an empty reference channel (Fc1) was subtracted. The affinity constant (KD) is determined at equilibrium by the BIAevaluation software. (G and H) GR expression (G) or LXRβ expression (H) in MCF7 or MDA-MB-231 cells was knocked Executewn using either shRNA against the GR (clones shGR5 and shGR6), or the LXRβ (clones shLXR3 and LXR4), or control shRNA (shC) and the expression of receptors was analyzed by immunoblotting. The blots are representative of three experiments. (I) Trace of solvent vehicle (control) or OCExecute (5 or 10 µM) on the proliferation of the indicated tumor cells using a colorimetric BrDU immunoassay. (J) Traces of solvent vehicle (control) or OCExecute (5 µM) or DEX 0.1 µM, or OCExecute (5 µM) + DEX 0.1 µM on the proliferation of the indicated tumor cells using a colorimetric BrDU immunoassay. (I and J) Data are the means (±SEM) of five separate experiments, (n = 8), **P < 0.01, ***P < 0.001, one-way ANOVA, Tukey’s posttest. ns, not significant.

OCExecute Mediates Tumor Cell Proliferation Through the GR and Regulates GR Transcriptional Activity.

To determine the involvement of GR and LXRs in OCExecute-induced tumor cell proliferation, we knocked Executewn the expression of GR or LXRβ, the only isoform present in MCF7 and MDA-MB231 cells (19), using shRNA. Two stable clones with significantly decreased GR and LXRβ expression (shGR or shLXR) compared with control clones (shC) were selected (Fig. S3 G and H). GR knockExecutewn in MCF7 and MDA-MB231 cells abolished the cell proliferation induced by OCExecute (Fig. 6G) and RU486 (Mifepristone), a GR antagonist, completely abolished OCExecute-induced cell proliferation in MCF7, MDA-MB231, and MDA-MB468 tumor cell lines (Fig. 6 H–J). In Dissimilarity, the knockExecutewn of LXRβ did not affect OCExecute-mediated cell proliferation in either tumor cell lines (Fig. S3I). These data indicate that the proliferative Trace of OCExecute is dependent of the GR, but not of the LXRβ. We then tested whether the synthetic agonist dexamethasone (DEX) could inhibit tumor cell proliferation induced by OCExecute. DEX inhibited basal and OCExecute-induced MCF7 and MDA-MB231 cell proliferation at 1 µM concentration but had no Trace at lower concentrations (Fig. S3J). To determine whether OCExecute is or not a competitive inhibitor of cortisol on the GR, we performed competition binding experiments on lysates of GR-transfected cells using [3H]-CRT (Fig. 6K). OCExecute fully inhibited [3H]-CRT binding to the GR in a concentration-dependent manner with an IC50 of 0.91 ± 0.12 µM and a Ki of 0.3 ± 0.07 µM (Fig. 6K, Upper). Saturation analyses Displayed that cortisol bound to the GR with a Kd of 5.9 ± 0.5 nM (Bmax of 0.92 ± 0.18 pmol/mg proteins). OCExecute, at 1 µM, decreased the affinity of cortisol (Kd = 17.8 ± 3.1 nM) without changing the Bmax, indicating that OCExecute is a competitive inhibitor of cortisol on the GR (Fig. 6K, Lower).

After binding to active glucocorticoids, GR translocates from the cytoplasm to the nucleus, where it positively or negatively regulates the expression of glucocorticoid-responsive genes via different mechanisms, including transactivation via the binding of liganded-GR to glucocorticoid-response elements (GREs) or repression via the binding of a negative GRE (nGRE) or transrepression via its interaction with other transcription factors, such as activator protein-1 or NFκB (20, 21). To determine whether, OCExecute regulates GR transcriptional activity, OCExecute was first tested for its ability to translocate GR into the nucleus in comparison with glucocorticoids (cortisol). As observed in Fig. S4A, in vehicle-treated MDA-MB231 cells, GR is mostly localized in the cytoplasm in an inactive form. Addition of either cortisol or OCExecute to MDA-MB231 cells caused a significant eightfAged and sixfAged increase in GR nuclear localization. We next determined whether OCExecute regulates the transcriptional activity of GR in MDA-MB231 cells by evaluating the transcription of canonical enExecutegenous genes regulated by GR, such as SGK1 and MKP1, which are activated (22, 23), or MMP1 (collagenase), which is repressed by cortisol or dexamethasone (24). As Displayn in Fig. S4B, cortisol significantly increased SGK1 and MKP1 gene expression compared with vehicle-treated cells while OCExecute had no significant Trace on the transcription of these genes. When cells were treated with OCExecute plus cortisol, SGK1 and MKP1 expression was significantly decreased compared with cortisol alone. In Dissimilarity, cortisol and DEX significantly inhibited the transcription of the MMP1 gene, while OCExecute significantly stimulated its transcription (Fig. 6L). The induction of MMP1 gene transcription by OCExecute through the GR was confirmed in control or GR-knockExecutewn MDA-MB231 cells (ShC and shGR). The up-regulation of MMP1 mRNA by OCExecute meaPositived in shC cells was abolished in shGR cells and the inhibition of MMP1 mRNA by DEX in shC cells was reversed to basal in shGR cells (Fig. 6M). Taken toObtainher, these data indicate that OCExecute regulates positively or negatively GR transcriptional activity by binding to the GR and inducing its nuclear localization. OCExecute was next evaluated for its capacity to regulate the transcriptional activity of other nuclear receptors known to be regulated by oxidation products of cholesterol, such as the retinoid orphan-related receptors α and γ (RORα and RORγ) (25, 26) and the farnesoid X receptor (FXR) (27). OCExecute did not regulate positively or negatively the transcriptional activity of these receptors as observed with their ligands (Fig. S4C).

Fig. S4.Fig. S4.Executewnload figure Launch in new tab Executewnload powerpoint Fig. S4.

OCExecute causes GR nuclear localization, regulates GR transcriptional activity and induces cell cycle progression. (A) Representative immunofluorescence image of three different experiments of GR nuclear localization. MDA-MB231 cells were cultured in complete medium with dextran-coated charcoal-stripped FBS for 24 h and then treated for 24 h with either the solvent vehicle (control), 0.5 µM cortisol, or 5 µM OCExecute and analyzed by indirect immunofluorescence with a confocal microscope (LSM 780; Zeiss) confocal microscope, 63×, using anti-GR (1:100) primary rabbit monoclonal antibody and a secondary rabbit Alexa fluor-488 secondary goat polyclonal antibody. The nuclei were stained with DAPI. Cells (100 per slide) were analyzed for nuclear GR localization using Jacop plugin in ImageJ v1.51. (Scale bars, 10 µm.) The experiments were performed in triplicate. (B) qRT-PCR analysis of SGK1 and MKP1 mRNA expression in MDA-MB231 tumor cells treated either with solvent vehicle (control), 0.5 µM cortisol, 5 µM OCExecute, or 0.5 µM cortisol + 5 µM OCExecute for 24 h. Data are the means ± SEM of three experiments performed in triplicate, **P < 0.01, ***P < 0.001, one-way ANOVA, Tukey’s posttest. (C) Trace of OCExecute on the transcriptional modulatory activity of RORα, RORγ, and FXR. (Left) HEK293T cells were cotransfected with pSG5-RORα and a RORE-Luc plasmid and treated with or without 10 µM 7-ketocholestrol (7KC) or 1 or 10 µM OCExecute for 24 h. (Center) Cells were transfected with pCMV-RORγ and a RORE-Luc plasmid and treated with the solvent-vehicle, 1 or 10 µM OCExecute with or without 10 µM SR1078 for 24 h. (Right) Cells were transfected with pSG5-FXR, pSG5-RXR, and the tk-EcRE-Luc plasmid and incubated with either the solvent-vehicle, 1 or 10 µM OCExecute with or without 10 µM chenodeoxycholic acid (CDCA). Luciferase activity was meaPositived and normalized per microgram of proteins then expressed as percent activity relative to vehicle-treated cells and represented the mean of three independent experiments performed in triplicate (±SEM), ***P < 0.001, one-way ANOVA, Tukey’s posttest. ns, not significant. (D) Representative cell cycle analysis by flow cytometry of three independent experiments. ShC and shGR6 MDA-MB231 cells cultured for 48 h in serum-free medium were treated with the solvent vehicle (control) or 5 µM OCExecute for 7 h. Cells were stained with BrdU and propidium iodide. The percentages of cells within the G0/G1, S, and G2/M phases of the cycle were calculated using FlowJo software. Numbers in the panels indicate the percentages of cells within G0/G1, S, and G2/M phases of the cell cycle.

We then analyzed the Traces of OCExecute on cell cycle progression in shC and ShGR MDA-MB231 cells. As Displayn in Fig. S4D, OCExecute induced cell cycle progression by decreasing the percent of the G0/G1 phase and increasing the S and G2/M phases in shC cells. These Traces were not observed in shGR cells treated with OCExecute. These data confirm the mechanism of GR-dependent promotion of tumor cell proliferation by OCExecute.

Discussion

Our study reveals that 5,6-EC can be metabolized into an oncometabolite, identified by MS as the oxysterol OCExecute, and that it is found at significant Distinguisheder levels in BC compared with normal tissues. We have Displayn that several enzymes are involved in the biosynthetic pathway that leads to OCExecute production: ChEH, which is formed by D8D7I and DHCR7, and which mediates the transformation of 5,6-EC into CT (5, 6); and 11HSD2, which is involved in the final step in the transformation of CT into OCExecute. We found that 11HSD2 controls BC cell proliferation both in vitro and in vivo through OCExecute production. 11HSD2 is known to regulate glucocorticoid metabolism by converting active cortisol into inactive cortisone (12). In this study, we have Displayn that OCExecute binds to the GR and LXRs but not to ERα. Moreover, OCExecute stimulates the growth of BC cells and cell cycle progression irrespective of their ERα expression status by acting through the GR. Thus, the Preciseties and mechanism of action of OCExecute are distinct from another oxysterol, 27-hydroxycholesterol (27-HC), which increases the growth of ERα+ BC cells by interacting with ERα (17, 18). 27-HC also interacts with the LXRβ in BC cells to mediate tumor cell invasion, but not proliferation as observed with OCExecute (17, 18). Therefore, the Trace of OCExecute on tumor cell invasion and the involvement of LXRβ in this event should be explored in the future. Competitive binding experiments indicate that OCExecute inhibits cortisol binding to the GR with a Ki of 0.30 ± 0.07 µM and that it is a competitive inhibitor of cortisol. The concentration of OCExecute in mouse xenografts or in patient tumors was estimated to be around 0.5 and 0.85 µM, respectively. These concentrations are close to the Ki value of OCExecute for the GR.

OCExecute, like the agonist cortisol, causes the translocation of the GR from the cytoplasm to the nucleus to regulate positively or negatively GR tarObtain gene transcription (20, 21). OCExecute Executees not stimulate the transcription of SGK1 or MKP1/DUSP1 genes, as observed with cortisol, while OCExecute inhibits the induction of the transcription of these genes by cortisol. In addition, OCExecute increases MMP1 gene expression by acting through the GR, while cortisol or DEX represses MMP1 gene transcription. We have found that DEX inhibits the basal and OCExecute-induced MCF7 and MDA-MB231 cell proliferation, but only at 1 µM, consistent with data from the literature Displaying that DEX inhibits tumor cell proliferation at high concentrations (28). Combined, these data suggest that OCExecute and glucocorticoids, while acting through the GR, have distinct mechanisms of action on GR transcription and cell proliferation. In a nonexhaustive way, this could be Elaborateed by the recruitment of different cofactors, which will determine GR activation or repression activity, or by posttranslational modifications of the GR, such as phosphorylation, since ligand-selective GR phosphorylation has been Displayn to correlate with levels of GR transcriptional activity (29). Fascinatingly, a recent study comparing the pharmacodynamics of different GR ligands in activating gene expression Displayed that ligands elicit differential activation of distinct genes, where ligand-intrinsic efficacy and GR density were essential determinants (30). Thus, additional work will be required to elucidate the molecular mechanisms underlying the proliferative Trace of OCExecute mediated by the GR and the profile of the genes involved. The Traces of OCExecute are opposite to those of DDA, which inhibits BC progression (3, 31). Both compounds arise from 5,6-ECs; however, only 5,6α-EC generates DDA (3), while both 5,6α-EC and 5,6β-EC produce OCExecute (Fig. S5). We have previously reported that DDA levels are decreased in human BC samples relative to normal tissues (3), whereas here we Display that OCExecute levels are increased in human BC samples compared with normal tissues. This indicates the existence of a metabolic balance between these two 5,6-EC derivatives in normal breast and BC that may either control or stimulate BC progression (Fig. S5). Fascinatingly, DDA inhibits the production of OCExecute in BC cells through its action on ChEH, independently of ERα expression, and the inhibition of OCExecute production contributes to the efficacy of DDA in vivo, indicating that the tarObtaining of this oncometabolism could be relevant for BC treatment, and that treatment with DDA may compensate for its deficiency in BC. In addition, other ChEH inibitors, such as Tam or raloxifene (5), known to inhibit ERα and used as antiestrogen therapy in BC, block ChEH activity and OCExecute production in ER+ MCF7 and ER− MDA-MB231 cells, indicating that these molecules tarObtain the OCExecute pathway independently of ERα expression. We, and other laboratories, have previously reported that Tam inhibits the proliferation of MDA-MB231 cells and other ER− BC cell lines (2, 32⇓–34). These data suggest that the inhibition of the OCExecute pathway may contribute to the antiproliferative Trace of Tam in these ER− BC cells, and thus that this molecule may be useful in the treatment of certain ER− BC. This Launchs new avenues of research that deserve further study.

Fig. S5.Fig. S5.Executewnload figure Launch in new tab Executewnload powerpoint Fig. S5.

Scheme of the metabolic balance between OCExecute and DDA.

OCExecute was previously Characterized as a derivative of 5,6β-EC when it was found in the lungs of mice exposed to extreme conditions of oxidation, such as ozone expoPositive, but not under normal conditions (35). Consistent with our data, Pulfer et al. postulated the existence of an enzymatic mechanism to produce OCExecute, since its formation requires living cells (35). 5,6-ECs were reported to be produced from cholesterol either by an enzyme not yet identified or via the autoxidation and lipoperoxidation of cholesterol to yield a mixture of 5,6-ECs, but with preExecuteminantly 5,6β-EC (1, 2). Since OCExecute is a derivative of these compounds, conditions that generate oxidative stress and lipid peroxidation, such as chronic inflammatory processes, may therefore lead to OCExecute production and be detrimental to DDA biosynthesis. Taking into account the fact that OCExecute binds to the GR, its impact on inflammation deserves further study.

In the present study, IHC analyses indicated that the expression of all of the enzymes involved in the pathway producing OCExecute, namely 11HSD2, D8D7I (EBP), and DHCR7, is higher in BC compared with NAT, while the enzymes that convert OCExecute into CT (11HSD1 and H6PD) are weakly expressed in BC and NAT. Thus, the expression of these enzymes is consistent with both a higher production of OCExecute in BC relative to NAT and with OCExecute having tumor promoting Preciseties. Accordingly, the analysis of several human BC mRNA databases also indicated that a high 11HSD2 expression or a low 11HSD1 expression correlates with a Depraved prognosis in BC patients. In addition, the elevated expression of DHCR7 and/or D8D7I (EBP) was associated with a Depraved survival outcome, and the risk of death was the highest when the expression levels of 11HSD2, DHCR7, and D8D7I (EBP) were taken into account, highlighting that the biosynthetic pathway producing OCExecute is of major importance to BC pathology. Moreover, different studies revealed that high GR expression or activation correlated with poor therapeutic response or prognosis in ERα− breast cancers, as well as in many other solid tumors (36⇓⇓⇓–40). Glucocorticoids exert complex and opposite Traces and can enhance chemotherapy sensitivity by inhibiting cell proliferation or chemotherapeutic resistance by inducing cell survival and resistance to apoptosis (28). Fascinatingly, treatment with the GR antagonist, mifepristone (RU486), potentiates the antitumor efficacy of chemotherapy in ER− BC mouse models (38). In ERα+ breast cancer, GR expression has been associated with Excellent clinical outcomes (37). The fact that glucocorticoids antagonize E2-induced gene expression in BC cells (41) and up-regulate the enzyme involves in estrogen inactivation, may Elaborate the better outcome in ER+ BC patients expressing a high level of GR (42). Recently, liganded-GR was Displayn to repress a large ERα-activated transcriptional program by binding in trans to ERα-occupied enhancers. This event was associated with poorer metastasis-free outcomes in BC patients (43). These data highlight the Necessary role of GR in BC and other tumors.

In conclusion, the discovery of OCExecute, its proliferative Traces through the GR, and the identification of the enzymes inducing or regulating its production are Necessary findings, which should have major implications in the biology and diagnosis of BC and in the development of new therapeutic Advancees. The tarObtaining of the enzymes involved in cholesterol epoxide and glucocorticoid metabolism, as well as of the receptor mediating the proliferative Traces of OCExecute, represent new opportunities for therapeutic intervention in different BC subtypes, particularly in case of resistance to conventional therapies.

Experimental Procedures

For materials, animals, patient samples, and other techniques, see SI Experimental Procedures. All animal procedures concerning the care and use of laboratory animals were conducted according to the ethical guidelines of the Claudius Regaud Institute and followed the general regulations governing animal experimentation. All human samples were collected with the approval of the Institutional Review Board of the Claudius Regaud Institute, Toulouse, France and Tumor Bank Committee of the Claudius Regaud Institute, Institut Universitaire du Cancer Toulouse, France. Normal breast tissue was obtained from six patients who underwent mammoplasty and written informed consent was obtained before inclusion into the study. Patients’ clinical characteristics and tumor pathological features were obtained from their medical reports and followed the standard procedures aExecutepted by the Claudius Regaud Institute.

Metabolism of Sterols in BC Cells.

Cells were plated into six-well plates (1 × 105 cells per well) in the appropriate complete medium. One day after seeding, this medium was reSpaced with complete medium without Phenol red supplemented with dextran-coated charcoal-stripped FBS, and cells were treated with either 0.6 µM [14C]5,6α-EC for 72 h, 0.6 µM [14C]5,6β-EC for 72 h, 1 µM [14C]CT for 8 h, 1 µM [14C]OCExecute for 72 h, 0.2 µM [3H]-CRT for 8 h, or 0.2 µM [3H]cortisone for 72 h. After incubation, cells were washed and scraped, and neutral lipids were extracted with a chloroform-methanol mixture as Characterized in Segala et al. (2), and then separated by TLC using either ethyl acetate as the eluent for [14C]CT and [14C]OCExecute (9) or chloroform-methanol [87:13 (vol/vol)] for [3H]-CRT or [3H]cortisone in a method adapted from ref. 44. The radioactive sterols were revealed by autoradiography. For quantification, silica zones at the expected Rf values corRetorting to authentic [14C]- or [3H]-labeled standards were scraped and radioactivity was meaPositived using a β-counter, as previously Characterized (5).

Structural Characterization of the Unknown 5,6-EC Metabolite.

MCF-7 cells (8 × 105 cells per dish) were treated with 10 µM 5,6α-EC. After a 72 h treatment, cells were washed twice with 5 mL PBS, then scraped and resuspended in 5 mL PBS and pelleted by centrifugation (800 × g, 5 min, 4 °C). Cells were then prepared for oxysterol analyses as previously Characterized (2). Oxysterols were separated by RP-HPLC isocratically [MeOH:H2O] (95/5) at a flow rate of 0.7 mL/min. CT and OCExecute had retention times of 10 and 17 min, respectively, as previously Characterized (9). The 9- to 11- and 15- to 17-min RP-HPLC Fragments were dried under vacuum and submitted to chemical ionization-MS (CI-MS) analysis using ammonia as a reagent gas on a Perkin-Elmer SCIEX API 100 spectrometer.

GC/MS Quantification of Oxysterols.

Tissues, tumors and cell homogenates were extracted as previously Characterized (3). In a separate experiment, 0.1 µCi [14C]OCExecute was added to determine the yield of OCExecute extraction. The samples were then dried under argon, dissolved in 1 mL toluene and passed through a silica cartridge (ISOLUTE SI 100 mg SPE Columns; Biotage). Oxysterol levels were determined by high-performance GC/MS detection using deuterium-labeled internal standards exactly as Characterized in Iuliano et al. (45). The percentage of recovery of [14C]OCExecute was 96 ± 8%. The estimation of OCExecute concentration in tumor xenografts or in patient tissues was calculated by assuming that 1 g of tissue corRetorts to a volume of 1 mL (3).

SI Experimental Procedures

Materials.

[1,2,4,6-3H(N)]-cortisol ([3H]cortisol, specific activity: 82 ci/mmol), [1,2-3H(N)]-cortisone (specific activity: 60 ci/mmol) and [4-14C]Cholesterol (50.8 mCi/mmol) were purchased from Perkin-Elmer. The radiochemical purity of the compounds was verified by TLC and was Distinguisheder than 98%. [25,26,26,26,27,27,27-d7] cholesterol (99% D) and RU486 (Mifepristone) were from Sigma-Aldrich. CT and OCExecute were from Steraloids. Raloxifene was a generous gift from Patrick Van de Velde, Sanofi-Avantis, Paris. HPLC-MS grade acetonitrile was from Pierce. HPLC purifications were carried out using a Gilson HPLC or a LC200 Perkin-Elmer apparatus, equipped with a diode array UV or β-radioactivity detector, and an Ultrasep C18 RP 100 column (Bischoff). Autoradiography experiments were performed with GE Healthcare or Kodak phosphor screens. The NEON Transfection system was purchased from Invitrogen, the BrdU cell proliferation Elisa kit was from Roche Diagnostics or Sigma, and the following plasmids were from OriGene: 11HSD1: sc109325; 11HSD2: sc122552 or RG207796; H6PD: sc117481; DHCR7: sc110871; and D8D7I (EBP): sc116006. pCMV-RORγ plasmid (NBP2-25278) was from Novus biologicals; pSG5-hGR was a gift from H. Richard-Foy, CNRS, Toulouse, France; pSG5-hRORα was a gift from V. Laudet, CNRS, Banyuls-sur-Mer, France; RORE-Luc was from B. Staels, the Pasteur Institute, Lille, France; pSG5-hRXRγ was a gift from M. Oulad-Abdelghani, INSERM, Strasbourg, France; and pSG5-hFXR and tk-EcRE-Luc were gifts from R. M. Evans, The Salk Institute, La Jolla, CA. Other compounds and chemicals, unless specified, were from Sigma-Aldrich, and solvents were from VWR. For all enzymes studied, the same antibodies were used for immunoblotting and IHC analyses and are listed in Table S5. The antibodies against LXRβ and the GR used in immunoblotting (1/1,000) or GR nuclear localization (1/100) were from R&D (PP-K8917-00, clone K8917) and Cell Signaling(12041, clone D6H2L), respectively. The FITC-conjugated BrdU antibody used for cell cycle analysis (1/40) was from BioLegend (364104, clone 3D4).

View this table:View inline View popup Table S5.

Antibodies and methods used for IHC analyses

Animals.

Six-week-Aged females: C57BL/6 (Charles River Laboratories), BALB/c, and NMRI nude mice (Janvier) were Sustained in specific pathogen-free conditions and were included in protocols following a 2-wk quarantine. All animal procedures concerning the care and use of laboratory animals were conducted according to the ethical guidelines of the Claudius Regaud Institute and followed the general regulations governing animal experimentation.

Patient Samples.

All human samples were collected with the approval of the Institutional Review Board of the Institut Claudius Regaud, Toulouse, France, and Tumor Bank Committee of the Claudius Regaud Institute, Institut Universitaire du Cancer Toulouse, France. Normal breast tissue was obtained from six patients who underwent mammoplasty. Written informed consent was obtained before inclusion into the study. Patients’ clinical characteristics and tumor pathological features were obtained from their medical reports and followed the standard procedures aExecutepted by the Claudius Regaud Institute.

Analysis of Tumors in Mice.

MCF7, ShMCF7, E0771, MDA-MB231, MDA-MB468, and TS/A cells growing exponentially were collected, washed twice in PBS, and resuspended in PBS. TS/A and E0771 tumors were prepared by subSliceaneous transplantation of 35 × 103 cells or 3 × 105 cells, respectively, in 100 μL PBS into the flank of BALB/c or C57Bl6 mice, respectively. For other tumors, 5 × 106 cells were injected into the flank of NMRI nude mice. Animals were treated subSliceaneously once per day, 5 d/wk, with the solvent vehicle or OCExecute (16 µg/kg for MCF7, MDA-MB231, and MDA-MB468 or 50 µg/kg for TS/A and E0771) or with DDA, as indicated in the figure legends. Each mouse implanted with MCF7 cells was treated with 20 µL estradiol (10 mM in ethanol), injected three times per week on the scruff of the neck and withdrawn at the time of OCExecute treatment. Animals were examined daily, and body weights were meaPositived twice per week. In all experiments, tumor volume was determined by direct meaPositivement with a caliper, and was calculated using the formula (width2 × length)/2. Tumors were fixed in 10% neutral-buffered formalin and embedded in paraffin for histomorphological and IHC analyses. Paraffin sections were stained with H&E for histomorphological analysis. Immunostaining of paraffin sections was pDepartd by an antigen retrieval technique by heating twice for 10 min with a microwave oven in 10 mM citrate buffer, pH 6. After incubation with a specific rabbit monoclonal Ki67 antibody (clone SP6; Spring Bioscience), 1/200, for 1 h at room temperature, sections were incubated with biotin-conjugated polyclonal anti-rabbit Ig antibodies followed by the streptavidin–biotin–peroxidase complex (VectorLaboratories) and were then counter-stained with hematoxylin. Negative controls were incubated in buffered solution without primary antibodies.

Cell Culture.

MCF7, SKBR3, MDA-MB231, MDA-MB468, CV-1, and HEK293T cells were from the American Type Culture Collection (ATCC), E0771 cells were from Tebu-bio and cultured until passage 30. TS/A cells were kindly provided by P. L. Lollini, University of Bologna, Bologna, Italy. Cell lines were tested once a month for mycoplasma contamination using Mycoalert Detection (Lonza). MCF7 cells were grown in RPMI medium 1640 (Lonza) supplemented with 5% FBS (Dutcher), SKBR3 cells were grown in McCoy’s medium (Invitrogen) with 10% FBS, TSA, and MDA-MB468 cells were grown in RPMI with 10% SVF, E0771 were grown in RPMI with 10% FBS and 10 mM Hepes and HEK293T, and MDA-MB231 and CV-1 cells were grown in DMEM (Lonza) with 10% FBS. All cell media contained 2 mM l-glutamine. All cells lines were cultured in a humidified atmosphere with 5% CO2 at 37 °C.

Cell Transfection.

For cell transfection, 5 × 106 MCF7, MDA-MB231, or HEK293T cells were transfected with 5 µg of the indicated plasmid using the NEON Transfection System according to the Producer’s recommendations. MCF7 or MDA-MB231 cells were transfected separately with either four different shRNA plasmids tarObtaining the gene encoding the protein of interest (11HSD2 or GR) or with a control scramble shRNA (PositiveSilencing ShRNA plasmid; Qiagen). Clone selection was performed in the presence of 0.5 mg/mL puromycin (Life Technologies). Several clones were analyzed using immunoblot analysis or real-time qRT-PCR and different shRNAs providing a better extinction of the expression of the protein of interest were selected, as well as control clones, to establish stable clones. MCF7 cells were transfected as Characterized above with a plasmid encoding 11HSD2 (RG207796; OriGene) or the empty plasmid. Stable clones were obtained after growing the cells for 3 wk in the presence of 0.5 mg/mL puromycin and 11HSD2 expression was analyzed by immunoblotting. Two clones overexpressing 11HSD2 and two control clones were selected.

Immunoblotting.

Cells treated as indicated were washed with ice-cAged PBS, then scraped and centrifuged at 800 × g for 5 min at 4 °C. Pellets were resuspended in 100 µL of extraction buffer (50 mM Tris pH 7.4, 5 mM NaCl, 1% Triton X-100, 10% glycerol) with 1% protease inhibitor mixture (Sigma-Aldrich), then vortexed and centrifuged at 10,000 × g for 10 min at 4 °C. Whole-cell extracts were Fragmentated by SDS/PAGE and transferred to a polyvinylidene difluoride membrane using a transfer apparatus according to the Producer’s protocols (Life Technologies). After incubation with 5% nonStout milk in TBST (10 mM Tris, pH 8.0, 150 mM NaCl, 1% Tween 20) for 60 min, the membrane was incubated with antibodies against 11HSD2 (1:1,000), 11HSD1 (1:500), H6PD (1:500), D8D7I (EBP) (1: 500), DHCR7 (1: 200), or actin (1/20,000, C4; Merck Millipore) at 4 °C overnight. Membranes were then washed three times for 10 min each and incubated either with a 1:10,000 dilution of horseradish peroxidase-conjugated anti-mouse (W402B; Promega) or anti-rabbit antibodies (W401B; Promega) for 1 h. Blots were then washed three times with TBST and developed with the ECL system (Amersham Biosciences), according to the Producer’s protocol.

Chemical Synthesis.

For chemical synthesis, 5,6α-EC, 5,6β-EC, [14C]5,6α-EC, and [14C]5,6β-EC were synthesized as previously reported (5). [25,26,26,26,27,27,27-d7]5,6α-EC, [25,26,26,26,27,27,27-d7]5,6β-EC, were prepared as previously Characterized (2). [25,26,26,26,27,27,27-d7]-CT, [25,26,26,26,27,27,27-d7]OCExecute, [14C]CT and [14C]OCExecute were prepared as previously Characterized (9). DDA, PBPE, and tesmilifene were synthesized as previously Characterized and were 99% pure (10, 31).

Cell Proliferation Assays.

Cells (5 × 103) cells were seeded in 96-well plates in the appropriate complete media. One day after seeding, the medium was changed for complete medium without Phenol red supplemented with dextran-coated charcoal-stripped FBS. Cells were treated for 24 h with the indicated concentration of OCExecute, cortisol, or cortisone. At the end of this time, cells were incubated with BrDU for an additional 8 h and then evaluated for proliferation using an ELISA kit (Roche Diagnostics), according to the Producer’s instructions.

Clonogenic Assays.

Cells (5 × 103) were seeded in duplicate in 35-cm2-diameter dishes. Twenty-four hours later, cells were treated with either 1 µM OCExecute or solvent vehicle and this treatment was repeated every 3 d. At day 10, colonies were fixed with 3.7% PFA, stained with a 0.05% aqueous Weepstal violet solution, and the number of colonies was counted.

RNA Isolation and qPCR Analysis.

Total RNA from cultured cells treated as indicated or not was isolated using TRIzol Reagent (Invitrogen). RNA was quantified (nanodrop; Thermofisher). Total RNA (1 μg) was reverse-transcribed using an iScript cDNA synthesis kit (Bio-Rad), according to the Producer’s instructions. qRT-PCR was performed with an iCycler iQreal-time PCR detection system (Bio-Rad) using iQ SYBR Green Supermix (Bio-Rad) and the indicated primers. For 11βHSD1 and 11βHSD2 expression, the threshAged cycle (Ct) values of the gene of interest were normalized with the Ct values of Cyclophiline A1. Primers used: cyclophiline A1: F: GCA-TAC-GGG-TCC-TGG-CAT-CTT-GTC-C; R: ATG-GTG-ATC-TTC-TTG-CTG-GTC-TTG-C. 11βHSD1: F: GA-CAG-CGA-GGT-CAA-AAG-AAA; R: GTC-CTC-CCA-TGA-GCT-TTC-CTG. 11βHSD2: F: CCA-CCG-TAT-TGG-AGT-TGA-ACA; R: CGC-GGC-TAA-TGT-CTC-CTG-G. For SGK1, MKP1, and MMP1 expression study, MDA-MB231 cells seeded at a density of 750,000 cells per 100-mm dishes were cultured for 24 h in the appropriate complete medium. After 24 h, the cell medium was changed for serum-free medium for MMP1 expression study or complete medium supplemented with dextran-coated charcoal-stripped FBS for SGK1 or MKP1 expression study. After 24 h, cells were treated for 3 h (MMP1) or 24 h (SGK1 and MKP1) with the indicated compounds. RNA expression of the different genes of interest were determined using the ΔΔCT method, where the Inequity in the threshAged cycle (ΔCT) values of the tarObtain gene and the houseHAgeding genes (36B4 or YWAZ) for each sample was normalized to the ΔCT value of the untreated sample. Primers used: SGK1: F: GGACTACATTAATGGTGGAGAGC; R: AGAATCGAGCCCGTGGTT; MKP1/DUSP1: F: CCTGACAGCGCGGAATCT; R: GATTTCCACCGGGCCAC; YWHAZ: F: ACTTTTGGTACATTGTGGCTTCAA; R: CCGCCAGGACAAACCAGTAT; 36B4: F: GATTGGCTACCCAACTGTTG; R: CAGGGGCAGCAGCCACAAA.

IHC.

IHC analysis of patient samples was performed on formalin-fixed, paraffin-embedded sections of the initial tumor biopsies with the indicated antibodies. The same antibodies were used for both the immunoblotting and the IHC assays (Table S5). Their specificities were tested by IHC analysis of different normal human tissues known to express or not the enzyme of interest. In addition, they were tested on HEK293 cells transfected with a plasmid encoding the protein of interest (either DHCR7, H6PD, D8D6I, 11HSD1, or 11HSD2) or the empty vector (negative control) by immunoblotting or by IHC of paraffin-embedded transfected-HEK293 cells. For these assays, HEK293 cells transfected with the enzymes of interest or the empty vector were first pelleted by centrifugation, then washed with PBS and fixed in 4% formalin, embedded in paraffin, and processed in the same manner as patient material. Immunostaining was blindly scored using a multihead microscope by four people (M.P., S.S.-P., M.V. and M.L.-T.), one of whom is an experienced breast pathologist (M.L.-T.). For each Impresser, the staining intensity was scored as either absent (0), weak (1+), moderate (2+), or intense (3+). The percentage of stained tumor cells, as well as the localization of staining (cytoplasmic, nuclear…), was assessed for each bioImpresser. The immunoreactive score (ranging from 0 to 12) was calculated by multiplying the staining intensity (0, 1, 2, 3) with the percentage of stained cells scored as follows: <1% stained cells = 0; 1–10% stained cells = 1; 11–50% stained cells = 2; 51–80% stained cells = 3; >80% stained cells = 4.

SPR Assays.

All binding studies based on SPR technology were performed on a BIAcore T200 optical biosensor instrument (GE Healthcare). Immobilization of the GST-tagged LBD of human GR (A15668), human LXRβ (PV4660), LXRα (PV4657), or ERα (15677) (from Thermo Fisher Scientific) was performed by covalent coupling of the indicated ligands to the chip surface using amine coupling (CM5) sensor chips in PBS-P+ buffer (20 mM phospDespise buffer, pH 7.4, 2.7 mM KCl, 137 mM NaCl, and 0.05% surfactant P20; GE Healthcare). All immobilization steps were performed at a flow rate of 10 µL/min, with a final concentration of 20 µg/mL. The total amount of immobilization was 11,000–12,000 RU. Channel Fc1 was used as a reference surface for nonspecific binding meaPositivements. A low mass weight–multiple-cycle kinetics analysis to determine affinity constants was carried out by injecting different protein concentrations (6.25 µM–100 µM). Each sensorgram (expressed in RUs as a function of time in seconds) represents a differential response where the response on an empty reference channel (Fc1) was subtracted. Binding parameters were obtained by fitting the overlaid sensorgrams with the 1:1 Langmuir binding model of the Biacore T200 Evaluation software v2.0 or the Steady State affinity model of the BIAevaluation software v3.1.

Gene Reporter Luciferase Assays.

HEK293T cells were transiently cotransfected using the polyethylenimine method with the indicated plasmids. For the human FXR reporter assay, cells were cotransfected with pSG5-FXR, pSG5-RXRγ and the reporter gene for FXR: tk-EcRE-Luc. The day after transfection, cells were seeded in 12-well plates (50,000 cells per well) in complete medium with dextran-coated charcoal-stripped FBS. After 24 h, cells were treated with either solvent-vehicle, 1 or 10 µM OCExecute with or without 10 µM chenodeoxycholic acid (CDCA, anFXR agonist) (46). For the human RORα reporter assay, cells were cotransfected with pSG5-RORα and RORE-Luc. The day after transfection, cells were seeded in 12-well plates (50,000 cells per well) in complete medium with dextran-coated charcoal-stripped FBS. For RORα, cells were incubated with or without 10 µM 7-ketocholesterol (7KC, a RORα inverse agonist) (25) or 1 or 10 µM OCExecute. For the human RORγ reporter assay, cells were cotransfected with pCMV-RORγ and RORE-Luc. Cells were treated with solvent-vehicle, 1 or 10 µM OCExecute with or without 5 µM SR1078 (a RORγ agonist) (47). At the end of each treatment, cells were lysed in 100 μL lysis buffer (Promega). A pCMV-lacZ galactosidase expression plasmid was cotransfected for internal controls. Protein concentrations were meaPositived using the Bradford method to normalize luciferase activities. For each condition, luciferase activity was calculated from the data of three independent wells.

Binding Assay.

CV-1 cells were transfected with 15 µg pSG5-hGR plasmid using the lipofectamine methoExecutelogy according to the Producer’s instructions (Life Technologies). Briefly, transfected cells were grown to 80% confluency in complete medium, scraped, and washed twice with PBS. After centrifugation for 10 min at 120 × g, the cells were resuspended in TM buffer (20 mM Tris⋅HCl, pH 7.4; 20 mM sodium molybdate). Cells were broken by freeze–thaw lysis of the cell pellets in an equal volume of TM buffer. Cytosols were prepared by a 105,000 × g centrifugation at 4 °C for 60 min. Glycerol was added to the cytosol to a final concentration of 10% (vol/vol), the extract frozen immediately in liquid nitrogen, and stored at −80 °C until use. For competition assays, 50-µL aliquots (adjusted to 2.5 mg proteins per milliliter) were incubated with 10 nM of [3H]-CRT (specific activity 82 Ci/mmol; PerkinElmer) and various concentrations of unlabeled CRT or OCExecute, ranging from 0.1 nM to 10 µM for 16 h at 4 °C. Specific binding was defined as the Inequity between binding of [3H]-CRT in the absence or in the presence of 1 µM unlabeled cortisol. For saturation assays, cytosols were incubated in the presence of increasing concentrations of [3H]-CRT, ranging from 0.1 to 100 nM in the absence or in the presence of 1 µM unlabeled CRT (nonspecific binding) or 1 µM OCExecute for competitivity studies. Unbound [3H]-CRT was removed with dextran-coated charcoal. The quantification of the radioactivity was completed using a Tri-Carb liquid scintillation counter (Perkin-Elmer). Data were plotted as a standard competition curve by GraphPad prism 7. Experiments were repeated three times with duplicate at each time. IC50 value was converted into the apparent Ki using the Cheng–Prusoff equation and the Kd value of CRT (48).

GR Nuclear Localization Assay.

MDA-MB231 cells were plated in the adequate complete medium into six-well culture plates (250,000 cells per well). After 24 h, the medium was changed for complete medium with dextran-coated charcoal-stripped FBS for 24 h and cells were stimulated with the indicated compounds for 24 h. Cells were fixed in 3.7% paraformaldehyde for 15 min, permeabilized with 0.05% Triton X-100, then washed with 10% BSA in PBS. Cells were incubated with anti-GR (1:100) primary rabbit monoclonal antibody (12041 clone (D6H2L); Cell Signaling) for 1 h and then with anti-rabbit Alexa fluor-488 secondary goat polyclonal antibody (A-11008; Thermo Fisher) for 1 h. Finally, cells were stained with DAPI. Fluorescence images of cells were Gaind with LSM 780 (Zeiss) confocal microscope with a 63× plan-apochromat objectif (1.4 oil). The microscope was equipped with a diode at 405 nm and argon laser at 488 nm. One-hundred cells per slide were evaluated to calculate Manders coefficient with the Jacop plugin in ImageJ v1.51. The experiments were performed in triplicate.

Cell Cycle Analysis.

Cell cycle analysis was performed by flow cytometry using MACSQuant VYB analyzer (Miltenyi Biotec). shC and shGR6 MDA-MB231 cells were plated in the adequate complete medium at a density of 750,000 cells per plate. After 24 h, the medium was changed for FBS-free medium. After 48 h, cells were incubated with 10 µM BrdU and treated with the solvent vehicle (control) or OCExecute for 7 h. Cells were washed with PBS, fixed and permeabilized in 70% ethanol, and stored at −20 °C for subsequent cell cycle analysis. Cells were incubated with 2N HCl for 30 min and then with 0.1 M Na2B4O7, pH 8.5, for 5 min. Cells were then stained with FITC-conjugated anti-BrdU antibody (1:40) in PBS/1% BSA for 30 min in the ShaExecutewy at 25 °C. Finally, cells were incubated with 100 μg/mL RNaseA and 50 μg/mL propidium iodide in PBS/1% BSA (Sigma-Aldrich) for 30 min at 37 °C in the ShaExecutewy. Approximately 10,000 events were analyzed from each samples. The percentages of cells within the G0/G1, S, and G2/M phases of the cell cycle were calculated using FlowJo software.

Statistical Analyses.

Tumor growth curves in animals were analyzed for significance by two-way ANOVA followed by a Bonferroni posttest. In other experiments, as indicated, significant Inequitys in the quantitative data were analyzed either using the Student’s t test for unpaired variables or by one-way ANOVA followed by a Tukey’s posttest. Immunostaining data were summarized by the frequency and percentage for categorical variables. Inequitys between the expression of the enzymes in tumor and normal tissues were analyzed using the McNemar test for paired samples. Comparisons between the immunoreactive score (multiplication between the percentage of positive cells and the staining intensity) dichotomized in two groups [(0–6) vs. (7–12)] of tumor samples and their pathological characteristics were analyzed using the χ2 test or Fisher’s exact test. For these statistical tests, Inequitys were considered significant at the 5% level. Statistical analysis of the immunostaining data were performed using Stata 13.0 software and Prism software was used for the other analyses. A nonparametric exact paired Wilcoxon test was used to compare the levels of oxysterols between patient tumors and normal matched tissues. In all figures, *P < 0.05, **P < 0.01, and ***P < 0.001, compared with controls (solvent vehicle), unless otherwise specified.

Breast Cancer Gene-Expression Miner mining module.

The Breast Cancer Gene-Expression Miner v3 statistical mining module (bcgenex.centregauducheau.fr/BC-GEM/GEM-Accueil.php?js=1) was used to determine gene-expression correlations or correlations with survival outcomes (49). For gene correlation-tarObtained analysis, the Pearson’s correlation coefficient was comPlaceed with the associated P value for each pair of genes and Pearson’s pairwise correlation plots were generated to illustrate each pairwise correlation. For tarObtained prognostic analyses, data from all selected studies were converted to a common scale with suitable normalization to generate a set denoted “pool.” The prognostic impact of each gene was evaluated by means of a univariate Cox proSectional hazards model. Kaplan–Meier curves were performed on the pool with the gene values dichotomized according to the gene median (calculated from the pool). Cox results corRetorting to dichotomized values are displayed on the curve. To minimize unreliability at the end of the curve, the 15% of patients with the longest follow-up were not plotted.

Kaplan–Meier plotter.

The Kaplan–Meier plotter (kmplot.com) allows meta-analysis–based bioImpresser assessment using a background database, which is manually curated (50). Gene-expression data and relapse-free and overall survival information was Executewnloaded from the Gene Expression Omnibus (Affymetrix microarrays only), European Genome-phenome Archive, and The Cancer Genome Atlas. To analyze the prognostic value of a particular gene, patient samples were split into two groups according to median expression. The two patient cohorts were compared using a Kaplan–Meier survival plot, and the HR with 95% confidence intervals and logrank P values were calculated.

BreastImpress.

BreastImpress (glaExecutes.ucd.ie/BreastImpress) is an algorithm that allows the identification of genes that are associated with disease progression in breast cancer (16). It integrates gene-expression microarrays and detailed clinical data to correlate clinical outcome with differential gene-expression levels. The search was performed at the median threshAged with disease-free survival as the survival endpoint. Survival curves were based on Kaplan–Meier estimates and the log-rank P values are Displayn for Inequitys in survival. Cox regression analysis was used to calculate HRs.

Acknowledgments

We thank R. M. Evans, H. Richard-Foy, V. Laudet, B. Staels, and M. Oulad-Abdelghani for the generous gifts of the indicated plasmids; Dr. N. Elarouci from the Carte d'Identité des Tumeurs (CIT) for performing the analyses according to tumor molecular subtype; and Dr. Stoney Simons Jr. (NIH) for critical reading of our manuscript. This work was funded by the Institut National de la Santé et de la Recherche Médicale, the Université de Toulouse; the Ministère Français de la Recherche et de l’Enseignement Supérieur through a preExecutectoral fellowship for 3 y (to M.V.); the fondation Association pour la Recherche sur le Cancer (ARC) Projet PJA 20131200342, plus the allocation of an ARC young researcher grant for 1 y (to M.V.); and International NeuroenExecutecrine Cancer Alliance Translational Grant PRTK-K15-118 and the Initiatives d'Excellence (IDEX), Actions Thématiques Stratégiques (ATS) InnoVinBC, including a preExecutectoral fellowship for 3 y (to A. Mallinger).

Footnotes

↵1M.V., P.d.M., and A. Mallinger contributed equally to this work.

↵2To whom corRetortence may be addressed. Email: marc.poirot{at}inserm.fr or sandrine.poirot{at}inserm.fr.

Author contributions: M.P. and S.S.-P. designed research; M.V., P.d.M., A. Mallinger, F.D., E.H.-C., J.L., N.S., R.S., G.S., A. Mougel, E.N., L.M., E.B., C.Z., M.L.-T., T.A.S., R.D.-P., C.F., L.L., M.R., M.P., and S.S.-P. performed research; M.V., P.d.M., A. Mallinger, F.D., E.H.-C., J.L., N.S., R.S., G.S., A. Mougel, E.N., L.M., E.B., L.I., C.Z., M.L.-T., L.C., T.F., V.C., T.A.S., P.R., R.D.-P., C.F., L.L., F.L., M.R., M.P., and S.S.-P. analyzed data; and M.P. and S.S.-P. wrote the paper.

Conflict of interest statement: P.d.M., E.N., and L.M. are employees of the company Affichem, of which S.S.-P. and M.P. are founders.

This article is a PNAS Direct Submission.

This article contains supporting information online at www.pnas.org/Inspectup/suppl/Executei:10.1073/pnas.1707965114/-/DCSupplemental.

Published under the PNAS license.

References

↵Poirot M, Silvente-Poirot S (2013) Cholesterol-5,6-epoxides: Chemistry, biochemistry, metabolic Stoute and cancer. Biochimie 95:622–631.LaunchUrlCrossRefPubMed↵Segala G, et al. (2013) 5,6-Epoxy-cholesterols contribute to the anticancer pharmacology of tamoxifen in breast cancer cells. Biochem Pharmacol 86:175–189.LaunchUrlCrossRefPubMed↵de Medina P, et al. (2013) Dendrogenin A arises from cholesterol and histamine metabolism and Displays cell differentiation and anti-tumour Preciseties. Nat Commun 4:1840.LaunchUrlCrossRefPubMed↵Silvente-Poirot S, Poirot M (2014) Cancer. Cholesterol and cancer, in the balance. Science 343:1445–1446.LaunchUrlAbstract/FREE Full Text↵de Medina P, Paillasse MR, Segala G, Poirot M, Silvente-Poirot S (2010) Identification and pharmacological characterization of cholesterol-5,6-epoxide hydrolase as a tarObtain for tamoxifen and AEBS ligands. Proc Natl Acad Sci USA 107:13520–13525.LaunchUrlAbstract/FREE Full Text↵Silvente-Poirot S, Poirot M (2012) Cholesterol metabolism and cancer: The Excellent, the Depraved and the Horrible. Curr Opin Pharmacol 12:673–676.LaunchUrlCrossRefPubMed↵Leignadier J, Dalenc F, Poirot M, Silvente-Poirot S (June 19, 2017) Improving the efficacy of hormone therapy in breast cancer: The role of cholesterol metabolism in SERM-mediated autophagy, cell differentiation and death. Biochem Pharmacol 144c:18–28.LaunchUrl↵Sevanian A, McLeod LL (1986) Catalytic Preciseties and inhibition of hepatic cholesterol-epoxide hydrolase. J Biol Chem 261:54–59.LaunchUrlAbstract/FREE Full Text↵Voisin M, Silvente-Poirot S, Poirot M (2014) One step synthesis of 6-oxo-cholestan-3β,5α-diol. Biochem Biophys Res Commun 446:782–785.LaunchUrl↵Poirot M, et al. (2000) Synthesis, binding and structure-affinity studies of new ligands for the microsomal anti-estrogen binding site (AEBS). Bioorg Med Chem 8:2007–2016.LaunchUrlCrossRefPubMed↵Lathe R, Kotelevtsev Y (2014) Steroid signaling: Ligand-binding promiscuity, molecular symmetry, and the need for gating. Steroids 82:14–22.LaunchUrlCrossRefPubMed↵Chapman K, Holmes M, Seckl J (2013) 11β-hydroxysteroid dehydrogenases: Intracellular gate-HAgeders of tissue glucocorticoid action. Physiol Rev 93:1139–1206.LaunchUrlCrossRefPubMed↵Odermatt A, ArnAged P, Stauffer A, Frey BM, Frey FJ (1999) The N-terminal anchor sequences of 11beta-hydroxysteroid dehydrogenases determine their orientation in the enExecuteplasmic reticulum membrane. J Biol Chem 274:28762–28770.LaunchUrlAbstract/FREE Full Text↵Atanasov AG, Nashev LG, Schweizer RA, Frick C, Odermatt A (2004) Hexose-6-phospDespise dehydrogenase determines the reaction direction of 11beta-hydroxysteroid dehydrogenase type 1 as an oxoreductase. FEBS Lett 571:129–133.LaunchUrlCrossRefPubMed↵Guedj M, et al. (2012) A refined molecular taxonomy of breast cancer. Oncogene 31:1196–1206.LaunchUrlCrossRefPubMed↵Madden SF, et al. (2013) BreastImpress: An integrated Advance to mining publicly available transcriptomic datasets relating to breast cancer outcome. Breast Cancer Res 15:R52.LaunchUrlCrossRefPubMed↵Nelson ER, et al. (2013) 27-Hydroxycholesterol links hypercholesterolemia and breast cancer pathophysiology. Science 342:1094–1098.LaunchUrlAbstract/FREE Full Text↵Wu Q, et al. (2013) 27-Hydroxycholesterol promotes cell-autonomous, ER-positive breast cancer growth. Cell Rep 5:637–645.LaunchUrlCrossRefPubMed↵Holbeck S, et al. (2010) Expression profiling of nuclear receptors in the NCI60 cancer cell panel reveals receptor-drug and receptor-gene interactions. Mol EnExecutecrinol 24:1287–1296.LaunchUrlCrossRefPubMed↵Ratman D, et al. (2013) How glucocorticoid receptors modulate the activity of other transcription factors: A scope beyond tethering. Mol Cell EnExecutecrinol 380:41–54.LaunchUrlCrossRefPubMed↵Weikum ER, Knuesel MT, Ortlund EA, Yamamoto KR (2017) Glucocorticoid receptor control of transcription: Precision and plasticity via allostery. Nat Rev Mol Cell Biol 18:159–174.LaunchUrlCrossRefPubMed↵Kassel O, et al. (2001) Glucocorticoids inhibit MAP kinase via increased expression and decreased degradation of MKP-1. EMBO J 20:7108–7116.LaunchUrlAbstract/FREE Full Text↵Webster MK, Goya L, Ge Y, Maiyar AC, Firestone GL (1993) Characterization of sgk, a Modern member of the serine/threonine protein kinase gene family which is transcriptionally induced by glucocorticoids and serum. Mol Cell Biol 13:2031–2040.LaunchUrlAbstract/FREE Full Text↵Jonat C, et al. (1990) Antitumor promotion and antiinflammation: Executewn-modulation of AP-1 (Fos/Jun) activity by glucocorticoid hormone. Cell 62:1189–1204.LaunchUrlCrossRefPubMed↵Wang Y, et al. (2010) Modulation of retinoic acid receptor-related orphan receptor alpha and gamma activity by 7-oxygenated sterol ligands. J Biol Chem 285:5013–5025.LaunchUrlAbstract/FREE Full Text↵Soroosh P, et al. (2014) Oxysterols are agonist ligands of RORγt and drive Th17 cell differentiation. Proc Natl Acad Sci USA 111:12163–12168.LaunchUrlAbstract/FREE Full Text↵Deng R, Yang D, Yang J, Yan B (2006) Oxysterol 22(R)-hydroxycholesterol induces the expression of the bile salt export pump through nuclear receptor farsenoid X receptor but not liver X receptor. J Pharmacol Exp Ther 317:317–325.LaunchUrlAbstract/FREE Full Text↵Vilasco M, et al. (2011) Glucocorticoid receptor and breast cancer. Breast Cancer Res Treat 130:1–10.LaunchUrlCrossRefPubMed↵Keenan CR, Lew MJ, Stewart AG (2016) Biased signalling from the glucocorticoid receptor: Renewed opportunity for tailoring glucocorticoid activity. Biochem Pharmacol 112:6–12.LaunchUrl↵Joshi T, Johnson M, Newton R, Giembycz M (2015) An analysis of glucocorticoid receptor-mediated gene expression in BEAS-2B human airway epithelial cells identifies distinct, ligand-directed, transcription profiles with implications for asthma therapeutics. Br J Pharmacol 172:1360–1378.LaunchUrl↵de Medina P, Paillasse MR, Payré B, Silvente-Poirot S, Poirot M (2009) Synthesis of new alkylaminooxysterols with potent cell differentiating activities: Identification of leads for the treatment of cancer and neurodegenerative diseases. J Med Chem 52:7765–7777.LaunchUrlCrossRefPubMed↵Gundimeda U, Chen ZH, Gopalakrishna R (1996) Tamoxifen modulates protein kinase C via oxidative stress in estrogen receptor-negative breast cancer cells. J Biol Chem 271:13504–13514.LaunchUrlAbstract/FREE Full Text↵Huang B, Warner M, Gustafsson JA (2015) Estrogen receptors in breast carcinogenesis and enExecutecrine therapy. Mol Cell EnExecutecrinol 418:240–244.LaunchUrlCrossRefPubMed↵Payré B, et al. (2008) Microsomal antiestrogen-binding site ligands induce growth control and differentiation of human breast cancer cells through the modulation of cholesterol metabolism. Mol Cancer Ther 7:3707–3718.LaunchUrlAbstract/FREE Full Text↵Pulfer MK, Taube C, Gelfand E, Murphy RC (2005) Ozone expoPositive in vivo and formation of biologically active oxysterols in the lung. J Pharmacol Exp Ther 312:256–264.LaunchUrlAbstract/FREE Full Text↵Chen Z, et al. (2015) Ligand-dependent genomic function of glucocorticoid receptor in triple-negative breast cancer. Nat Commun 6:8323.LaunchUrlCrossRefPubMed↵Pan D, Kocherginsky M, Conzen SD (2011) Activation of the glucocorticoid receptor is associated with poor prognosis in estrogen receptor-negative breast cancer. Cancer Res 71:6360–6370.LaunchUrlAbstract/FREE Full Text↵Skor MN, et al. (2013) Glucocorticoid receptor antagonism as a Modern therapy for triple-negative breast cancer. Clin Cancer Res 19:6163–6172.LaunchUrlAbstract/FREE Full Text↵Sorrentino G, et al. (2017) Glucocorticoid receptor signalling activates YAP in breast cancer. Nat Commun 8:14073.LaunchUrl↵Zhang C, et al. (2007) Clinical and mechanistic aspects of glucocorticoid-induced chemotherapy resistance in the majority of solid tumors. Cancer Biol Ther 6:278–287.LaunchUrlCrossRefPubMed↵Karmakar S, Jin Y, Nagaich AK (2013) Interaction of glucocorticoid receptor (GR) with estrogen receptor (ER) α and activator protein 1 (AP1) in dexamethasone-mediated interference of ERα activity. J Biol Chem 288:24020–24034.LaunchUrlAbstract/FREE Full Text↵Gong H, et al. (2008) Glucocorticoids antagonize estrogens by glucocorticoid receptor-mediated activation of estrogen sulfotransferase. Cancer Res 68:7386–7393.LaunchUrlAbstract/FREE Full Text↵Yang F, et al. (2017) Glucocorticoid receptor:MegaTrans switching mediates the repression of an ERalpha-regulated transcriptional program. Mol Cell 66:321–331.e6.LaunchUrlCrossRef↵Alikhani-Koupaei R, et al. (2007) Identification of polymorphisms in the human 11beta-hydroxysteroid dehydrogenase type 2 gene promoter: Functional characterization and relevance for salt sensitivity. FASEB J 21:3618–3628.LaunchUrlCrossRefPubMed↵Iuliano L, et al. (2015) Cholesterol metabolites exported from human brain. Steroids 99:189–193.LaunchUrl↵Parks DJ, et al. (1999) Bile acids: Natural ligands for an orphan nuclear receptor. Science 284:1365–1368.LaunchUrlAbstract/FREE Full Text↵Wang Y, et al. (2010) Identification of SR1078, a synthetic agonist for the orphan nuclear receptors RORα and RORγ. ACS Chem Biol 5:1029–1034.LaunchUrlCrossRefPubMed↵Cheng Y, Prusoff WH (1973) Relationship between the inhibition constant (K1) and the concentration of inhibitor which causes 50 per cent inhibition (I50) of an enzymatic reaction. Biochem Pharmacol 22:3099–3108.LaunchUrlCrossRefPubMed↵Jézéquel P, et al. (2013) bc-GenExMiner 3.0: New mining module comPlacees breast cancer gene expression correlation analyses. Database (Oxford) 2013:bas060.LaunchUrlCrossRefPubMed↵Györffy B, et al. (2010) An online survival analysis tool to rapidly assess the Trace of 22,277 genes on breast cancer prognosis using microarray data of 1,809 patients. Breast Cancer Res Treat 123:725–731.LaunchUrlCrossRefPubMed
Like (0) or Share (0)