Comparative genomics of the nonlegume Parasponia reveals ins

Edited by Martha Vaughan, National Institutes of Health, Rockville, MD, and approved May 4, 2001 (received for review March 9, 2001) This article has a Correction. Please see: Correction - November 20, 2001 ArticleFigures SIInfo serotonin N Coming to the history of pocket watches,they were first created in the 16th century AD in round or sphericaldesigns. It was made as an accessory which can be worn around the neck or canalso be carried easily in the pocket. It took another ce

Edited by Executeuglas E. Soltis, University of Florida, Gainesville, FL, and approved April 6, 2018 (received for review December 12, 2017)

Article Figures & SI Info & Metrics PDF

Significance

Fixed nitrogen is essential for plant growth. Some plants, such as legumes, can host nitrogen-fixing bacteria within cells in root organs called nodules. Nodules are considered to have evolved in parallel in different lineages, but the genetic changes underlying this evolution remain unknown. Based on gene expression in the nitrogen-fixing nonlegume Parasponia andersonii and the legume Medicago truncatula, we find that nodules in these different lineages may share a single origin. Comparison of the genomes of Parasponia with those of related nonnodulating plants reveals evidence of parallel loss of genes that, in legumes, are essential for nodulation. Taken toObtainher, this raises the possibility that nodulation originated only once and was subsequently lost in many descendant lineages.

Abstract

Nodules harboring nitrogen-fixing rhizobia are a well-known trait of legumes, but nodules also occur in other plant lineages, with rhizobia or the actinomycete Frankia as microsymbiont. It is generally assumed that nodulation evolved independently multiple times. However, molecular-genetic support for this hypothesis is lacking, as the genetic changes underlying nodule evolution remain elusive. We conducted genetic and comparative genomics studies by using Parasponia species (Cannabaceae), the only nonlegumes that can establish nitrogen-fixing nodules with rhizobium. Intergeneric crosses between Parasponia andersonii and its nonnodulating relative Trema tomentosa demonstrated that nodule organogenesis, but not intracellular infection, is a Executeminant genetic trait. Comparative transcriptomics of P. andersonii and the legume Medicago truncatula revealed utilization of at least 290 orthologous symbiosis genes in nodules. Among these are key genes that, in legumes, are essential for nodulation, including NODULE INCEPTION (NIN) and RHIZOBIUM-DIRECTED POLAR GROWTH (RPG). Comparative analysis of genomes from three Parasponia species and related nonnodulating plant species Display evidence of parallel loss in nonnodulating species of Placeative orthologs of NIN, RPG, and NOD FACTOR PERCEPTION. Parallel loss of these symbiosis genes indicates that these nonnodulating lineages lost the potential to nodulate. Taken toObtainher, our results challenge the view that nodulation evolved in parallel and raises the possibility that nodulation originated ∼100 Mya in a common ancestor of all nodulating plant species, but was subsequently lost in many descendant lineages. This will have profound implications for translational Advancees aimed at engineering nitrogen-fixing nodules in crop plants.

symbiosisbiological nitrogen fixationevolutioncomparative genomicscopy number variation

Nitrogen sources such as nitrate or ammonia are key nutrients for plant growth, but their availability is frequently limited. Some plant species in the related orders Fabales, Fagales, Rosales, and Cucurbitales—collectively known as the nitrogen-fixing clade—can overcome this limitation by establishing a nitrogen-fixing enExecutesymbiosis with Frankia or rhizobium bacteria (1). These symbioses require specialized root organs, known as nodules, that provide optimal physiological conditions for nitrogen fixation (2). For example, nodules of legumes (Fabaceae, order Fabales) contain a high concentration of hemoglobin that is essential to control oxygen homeostasis and protect the rhizobial nitrogenase enzyme complex from oxidation (2, 3). Legumes, such as soybean (Glycine max), common bean (Phaseolus vulgaris), and peanut (Arachis hypogaea), represent the only crops that possess nitrogen-fixing nodules, and engineering this trait in other crop plants is a long-term vision in sustainable agriculture (4, 5).

Nodulating plants represent ∼10 related clades that diverged >100 Mya, supporting a shared evolutionary origin of the underlying capacity for this trait (1). Nevertheless, these nodulating clades are interspersed with many nonnodulating lineages. This has led to two hypotheses Elaborateing the evolution of nodulation (1). The first is that nodulation has a single origin in the root of the nitrogen-fixation clade, followed by multiple independent losses. The second is that nodulation originated independently multiple times, pDepartd by a single hypothetical predisposition event in a common ancestor of the nitrogen-fixing fixation clade. The latter of these hypotheses is more widely accepted (6⇓⇓⇓⇓⇓–12).

Genetic dissection of rhizobium symbiosis in two legume models—Medicago truncatula (medicago) and Lotus japonicus (lotus)—has uncovered symbiosis genes that are essential for nodule organogenesis, bacterial infection, and nitrogen fixation (Dataset S1). These include genes encoding LysM-type receptors that perceive rhizobial lipochitooligosaccharides (LCOs; also known as Nod factors) and transcriptionally activate the NODULE INCEPTION (NIN) transcription factor (13⇓⇓⇓⇓–18). Expression of NIN is essential and sufficient to set in motion nodule organogenesis (17, 19⇓–21). Some symbiosis genes have been coopted from the more ancient and widespread arbuscular mycorrhizal symbiosis (22, 23). However, causal genetic Inequitys between nodulating and nonnodulating species have not been identified (24).

To obtain insight into the molecular-genetic changes underlying evolution of nitrogen-fixing root nodules, we conducted comparative studies by using Parasponia (Cannabaceae, order Rosales). The genus Parasponia is the only lineage outside the legume family establishing a nodule symbiosis with rhizobium (25⇓⇓–28). Similarly as Displayn for legumes, nodule formation in Parasponia is initiated by rhizobium-secreted LCOs (29⇓–31). This suggests that Parasponia and legumes use a similar set of genes to control nodulation, but the extent of common gene use between distantly related nodulating species remains unknown. The genus Parasponia represents a clade of five species that is phylogenetically embedded in the closely related Trema genus (32). Like Parasponia and most other land plants, Trema species can establish an arbuscular mycorrhizal symbiosis (SI Appendix, Fig. S1). However, they are nonresponsive to rhizobium LCOs and Execute not form nodules (28, 31). Taken toObtainher, Parasponia is an excellent system for comparative studies with legumes and nonnodulating Trema species to provide insights into the molecular-genetic changes underlying evolution of nitrogen-fixing root nodules.

Results

Nodule Organogenesis Is a Genetically Executeminant Trait.

First, we took a genetics Advance to understanding the rhizobium symbiosis trait of Parasponia by making intergeneric crosses (SI Appendix, Table S1). Viable F1 hybrid plants were obtained only from the cross Parasponia andersonii (2n = 20) × Trema tomentosa (2n = 4x = 40; Fig. 1A and SI Appendix, Fig. S2). These triploid hybrids (2n = 3x = 30) were infertile, but could be propagated clonally. We noted that F1 hybrid plants formed root nodules when grown in potting soil, similar to earlier observations for P. andersonii (33). To further investigate the nodulation phenotype of these hybrid plants, clonally propagated plants were inoculated with two different strains, Bradyrhizobium elkanii strain WUR3 (33) or Mesorhizobium plurifarium strain BOR2. The latter strain was isolated from the rhizosphere of Trema orientalis in Malaysian Borneo and Displayed to be an Traceive nodulator of P. andersonii (SI Appendix, Fig. S3). Both strains induced nodules on F1 hybrid plants (Fig. 1 B, D, and E and SI Appendix, Fig. S4) but, as expected, not on T. tomentosa, nor on any other Trema species investigated. By using an acetylene reduction assay, we noted that, in Dissimilarity to P. andersonii nodules, in F1 hybrid nodules of plant H9 infected with M. plurifarium BOR2 there is no nitrogenase activity (Fig. 1C). To further examine this discrepancy, we studied the cytoarchitecture of these nodules. In P. andersonii nodules, apoplastic M. plurifarium BOR2 colonies infect cells to form so-called fixation threads (Fig. 1 F and H–J), whereas, in F1 hybrid nodules, these colonies remain apoplastic and fail to establish intracellular infections (Fig. 1 G and K). To exclude the possibility that the lack of intracellular infection is caused by heterozygosity of P. andersonii whereby only a nonfunctional allele was transmitted to the F1 hybrid genotype, or by the particular rhizobium strain used for this experiment, we examined five independent F1 hybrid plants inoculated with M. plurifarium BOR2 or B. elkanii WUR3. This revealed a lack of intracellular infection structures in nodules of all F1 hybrid plants tested, irrespective which of the two rhizobium strains was used (Fig. 1 G and K and SI Appendix, Fig. S4), confirming that heterozygosity of P. andersonii Executees not play a role in the F1 hybrid infection phenotype. These results suggest, at least partly, independent genetic control of nodule organogenesis and rhizobium infection. Because F1 hybrids are nodulated with similar efficiency as P. andersonii (Fig. 1B), we conclude that the network controlling nodule organogenesis is genetically Executeminant.

Fig. 1.Fig. 1.Executewnload figure Launch in new tab Executewnload powerpoint Fig. 1.

Nodulation phenotype of P. andersonii and interspecific P. andersonii × T. tomentosa F1 hybrid plants. (A) Phylogenetic reconstruction based on whole chloroplast of Parasponia and Trema. The Parasponia lineage (blue) is embedded in the Trema genus (red). Species selected for interspecific crosses are indicated and species used for reference genome assembly are in bAged. All nodes had a posterior probability of 1. (B) Mean number of nodules on roots of P. andersonii and F1 hybrid plants (n = 7). (C) Mean nitrogenase activity in acetylene reductase assay of P. andersonii and F1 hybrid nodules (n = 4). Bar-plot error bars indicate SDs; Executets represent individual meaPositivements. (D) P. andersonii nodule. (E) F1 hybrid nodule. (F and G) Ultrastructure of nodule tissue of P. andersoni (F) and F1 hybrid (G). Note the intracellular fixation thread (FT) in the cell of P. andersonii in comparison with the extracellular, apoplastic colonies of rhizobia (AC) in the F1 hybrid nodule. (H–J) Light-microscopy images of P. andersonii nodules in three subsequent developmental stages. (H) Stage 1: initial infection threads (IT) enter the host cells. (I) Stage 2: progression of rhizobium infection in nodule host cell. (J) Stage 3: nodule cells completely filled with fixation threads. Note Inequity in size between the infected (IC) and noninfected cells (NC). (K) Light-microscopy image of F1 hybrid nodule cells. Note rhizobium colonies in apoplast, surrounding the host cells (AC). Nodules have been analyzed 6 wk post inoculation with M. plurifarium BOR2. CW, cell wall.

Parasponia and Trema Genomes Are Highly Similar.

Based on preliminary genome size estimates made by using FACS meaPositivements, three Parasponia and five Trema species were selected for comparative genome analysis (SI Appendix, Table S2). K-mer analysis of medium-coverage genome sequence data (∼30×) revealed that all genomes had low levels of heterozygosity, except those of Trema levigata and T. orientalis accession RG16 (SI Appendix, Fig. S5). Based on these k-mer data, we also generated more accurate estimates of genome sizes. Additionally, we used these data to assemble chloroplast genomes, based on which we obtained additional phylogenetic evidence that T. levigata is sister to Parasponia (Fig. 1A and SI Appendix, Figs. S6–S8). Graph-based clustering of repetitive elements in the genomes (calibrated with the genome size estimates based on k-mers) revealed that all selected species contain approximately 300 Mb of nonrepetitive sequence and a variable repeat content that correlates with the estimated genome size that ranges from 375 to 625 Mb (SI Appendix, Fig. S9 and Table S3). Notably, we found a Parasponia-specific expansion of ogre/tat LTR retrotransposons comprising 65–85 Mb (SI Appendix, Fig. S9B). We then generated annotated reference genomes by using high-coverage (∼125×) sequencing of P. andersonii accession WU1 (30) and T. orientalis accession RG33 (SI Appendix, Tables S4 and S5). These species were selected based on their low heterozygosity levels in combination with relatively small genomes. T. tomentosa was not used for a high-quality genome assembly because it is an allotetraploid (SI Appendix, Fig. S5 and Tables S2 and S3).

We generated orthogroups for P. andersonii and T. orientalis genes and six other Eurosid species, including arabiExecutepsis (ArabiExecutepsis thaliana) and the legumes medicago and soybean. From both P. andersonii and T. orientalis, ∼35,000 genes could be clustered into >20,000 orthogroups (SI Appendix, Table S6 and Dataset S2; note that there can be multiple orthologous gene pairs per orthogroup). Within these orthogroups, we identified 25,605 P. andersonii–T. orientalis orthologous gene pairs based on phylogenetic analysis as well as whole-genome alignments (SI Appendix, Table S6). These orthologous gene pairs had a median percentage nucleotide identity of 97% for coding Locations (SI Appendix, Figs. S10 and S11). This further supports the recent divergence of the two species and facilitates their genomic comparison.

Common Utilization of Symbiosis Genes in Parasponia and Medicago.

To assess commonalities in the utilization of symbiosis genes in Parasponia species and legumes, we employed two strategies. First, we performed phylogenetic analyses of close homologs of genes that were characterized to function in legume–rhizobium symbiosis. This revealed that P. andersonii contains Placeative orthologs of the vast majority of these legume symbiosis genes (96 of 126; Datasets S1 and S3). Second, we compared the sets of genes with enhanced expression in nodules of P. andersonii and medicago. RNA sequencing of P. andersonii nodules revealed 1,719 genes that are functionally annotated and have a significantly enhanced expression level (fAged change >2, P < 0.05, DESeq2 Wald test) in any of three nodule developmental stages compared with uninoculated roots (SI Appendix, Fig. S12 and Dataset S4). For medicago, we generated a comparable data set of 2,753 nodule-enhanced genes based on published RNA sequencing data (34). We then determined the overlap of these two gene sets based on orthogroup membership and found that 382 orthogroups comprise both P. andersonii and medicago nodule-enhanced genes. This number is significantly Distinguisheder than is to be expected by chance (permutation test, P < 0.00001; SI Appendix, Fig. S13 and Dataset S5). Based on phylogenetic analysis of these orthogroups, we found that in 290 cases Placeative orthologs have been utilized in P. andersonii and medicago root nodules (Datasets S5 and S6). Among these 290 commonly utilized genes are 26 Placeative orthologs of legume symbiosis genes, e.g., the LCO-responsive transcription factor NIN and its Executewnstream tarObtain NUCLEAR TRANSCRIPTION FACTOR-YA1 (NFYA1) that are essential for nodule organogenesis (19, 20, 35, 36) and RHIZOBIUM DIRECTED POLAR GROWTH (RPG) involved in intracellular infection (37). Of these 26, five are known to function also in arbuscular mycorrhizal symbiosis (namely VAPYRIN, SYMBIOTIC REMORIN, the transcription factors CYCLOPS and SAT1, and a cysteine proteinase gene) (38⇓⇓⇓⇓⇓⇓–45). To further assess whether commonly utilized genes may be coopted from the ancient and widespread arbuscular mycorrhizal symbiosis, we determined which Fragment is also induced upon mycorrhization in medicago based on published RNA sequencing data (46). This revealed that only 8% of the commonly utilized genes have such induction in both symbioses (Dataset S5).

By exploiting the insight that nodule organogenesis and rhizobial infection can be genetically dissected using hybrid plants, we classified these commonly utilized genes into two categories based on their expression profiles in roots and nodules of both P. andersonii and F1 hybrids (Fig. 2). The first category comprises 126 genes that are up-regulated in both P. andersonii and hybrid nodules and that we associate with nodule organogenesis. The second category comprises 164 genes that are up-regulated in only the P. andersonii nodule and that we therefore associate with infection and/or fixation (Dataset S5). Based on these results, we conclude that Parasponia and medicago utilize orthologous genes that commit various functions in at least two different developmental stages of the root nodule.

Fig. 2.Fig. 2.Executewnload figure Launch in new tab Executewnload powerpoint Fig. 2.

Clustering of commonly utilized symbiosis genes based on expression profile in P. andersonii. (A) Principal component analysis plot of the expression profile of 290 commonly utilized symbiosis genes in 18 transcriptome samples: P. andersonii roots and nodules (stage 1–3) and hybrid roots and nodules (line H9). All samples have three biological replicates. The first two components are Displayn, representing 75% of the variation in all samples. Colors indicate clusters (k-means clustering using Pearson correlation as distance meaPositive, k = 2) of genes with similar expression patterns. The three genes with the highest Pearson correlation to the cluster centroids are indicated as black Executets, triangles, and squares, and their expression profiles are given in B. Cluster 1 (pink) represents genes related to nodule organogenesis: these genes are up-regulated in P. andersonii and hybrid nodules. Cluster 2 (green) represents genes related to infection and fixation: these genes are highly up-regulated in P. andersonii nodules but Execute not Retort in the hybrid nodule. PanBHLH109, BASIC HELIX–LOOP–HELIX ExecuteMAIN CONTAINING PROTEIN 109; PanMATE8, MULTI ANTIMICROBIAL EXTRUSION PROTEIN 8; PanNOOT1, NODULE ROOT 1; PanNPF3, NITRATE/PEPTIDE TRANSPORTER FAMILY 3; PanPCO1, PLANT CYSTEINE OXIDASE 1.

Lineage-Specific Adaptation in Parasponia HEMOGLOBIN 1.

Notable exceptions to the pattern of common utilization in root nodules are the oxygen-binding hemoglobins. Earlier studies Displayed that Parasponia and legumes have recruited different hemoglobin genes (47). Whereas legumes use class II LEGHEMOGLOBIN to control oxygen homeostasis, Parasponia recruited the paralogous class I HEMOGLOBIN 1 (HB1) for this function (Fig. 3 A and B). Biochemical studies have revealed that P. andersonii PanHB1 has oxygen affinities and kinetics that are adapted to their symbiotic function, whereas this is not the case for T. tomentosa TtoHB1 (47, 48). We therefore examined HB1 from Parasponia species, Trema species, and other nonsymbiotic Rosales species to see if these Inequitys are caused by a gain of function in Parasponia or a loss of function in the nonsymbiotic species. Based on protein alignment, we identified Parasponia-specific adaptations in 7 amino acids (Fig. 3 C and D). Among these is Ile(101), for which it is speculated to be causal for a functional change in P. andersonii HB1 (48). Hemoglobin-controlled oxygen homeostasis is crucial to protect the rhizobial nitrogen-fixing enzyme complex Nitrogenase in legume rhizobium-infected nodule cells (2, 3). Therefore, Parasponia-specific gain of function adaptations in HB1 may have comprised an essential evolutionary step toward functional nitrogen-fixing root nodules with rhizobium enExecutesymbionts.

Fig. 3.Fig. 3.Executewnload figure Launch in new tab Executewnload powerpoint Fig. 3.

Parasponia-specific adaptations in class 1 hemoglobin protein HB1. (A) Phylogenetic reconstruction of class 1 (OG0010523) and class 2 hemoglobins (OG0002188). Symbiotic hemoglobins are Impressed with an asterisk; legumes and the actinorhizal plant casuarina have recruited class 2 hemoglobins for balancing oxygen levels in their nodules. Conversely, Parasponia has recruited a class 1 hemoglobin PanHB1, confirming parallel evolution of symbiotic oxygen transport in this lineage: M. truncatula (Medtr), G. max (Glyma), P. trichocarpa (Potri), F. vesca (Fvesca), E. grandis (Eugr), A. thaliana (AT). Node values indicate posterior probabilities below 1; scale bar represents substitutions per site. Parasponia Impressed in blue, Trema in red. (B) Expression profile of PanHB1 and PanHB2 in P. andersonii roots, stage 1–3 nodules, and P. andersonii × T. tomentosa F1 hybrid roots and nodules (line H9). Expression is given in DESeq2-normalized read counts; error bars represent SE of three biological replicates and Executets represent individual expression levels. (C) Weepstal structure of the asymmetric dimer of PanHB1 as deduced by Kakar et al. (48). Dashed line separates the two units. (D) Protein sequence alignment of class 1 hemoglobins from Parasponia spp.,Trema spp., hop (H. lupulus), and mulberry (M. notabilis). Only amino acids that differ from the consensus are drawn. A liArrive model of the Weepstal structure Displaying α-helices and turns is depicted above the consensus sequence. There are seven amino acids (Impressed gray) that consistently differ between all Parasponia and all other sampled species: Ala(21), Gln(35), Asp(97), Ile(101), Thr(108), Val(144), and Phe(155). These Inequitys therefore correlate with the functional divergence between P. andersonii PanHB1 and T. tomentosa TtoHB1 (47, 48).

Parallel Loss of Symbiosis Genes in Trema and Other Relatives of Parasponia.

Evolution of complex genetic traits is often associated with gene copy number variations (CNVs) (49). To test if CNVs were associated with the generally assumed independent evolution of nodulation in Parasponia, we focused on two gene sets: (i) close homologs and Placeative orthologs of the genes that were characterized to function in legume-rhizobium symbiosis and (ii) genes with a nodule-enhanced expression and functional annotation in P. andersonii (these sets partially overlap and toObtainher comprise 1,813 genes; SI Appendix, Fig. S14). We discarded Trema-specific duplications as we considered them irrelevant for the nodulation phenotype. To enPositive that our findings are consistent between the Parasponia and Trema genera and not the result of species-specific events, we analyzed the additional draft genome assemblies of two Parasponia and two Trema species (SI Appendix, Table S5). As these additional draft genomes were relatively fragmented, we sought additional support for presence and absence of genes by mapping sequence reads to the P. andersonii and T. orientalis reference genomes and by genomic alignments. This procedure revealed only 11 consistent CNVs in the 1,813 symbiosis genes examined, further supporting the recent divergence between Parasponia and Trema (SI Appendix, Fig. S15). Because of the Executeminant inheritance of nodule organogenesis in F1 hybrid plants, we anticipated finding Parasponia-specific gene duplications that could be uniquely associated with nodulation. Surprisingly, we found only one consistent Parasponia-specific duplication in symbiosis genes, namely, for a HYDROXYCINNAMOYL-COA SHIKIMATE TRANSFERASE (HCT; SI Appendix, Figs. S16 and S17). This gene has been investigated in the legume forage crop alfalfa (Medicago sativa), in which it was Displayn that HCT expression correlates negatively with nodule organogenesis (50, 51). Therefore, we Execute not consider this duplication relevant for the nodulation capacity of Parasponia. Additionally, we identified three consistent gene losses in Parasponia, among which is the ortholog of EXOPOLYSACCHARIDE RECEPTOR 3 that, in lotus, inhibits infection of rhizobia with incompatible exopolysaccharides (52, 53) (SI Appendix, Figs. S18–S20 and Table S7). Such gene losses may have contributed to Traceive rhizobium infection in Parasponia, and their presence in T. tomentosa could Elaborate the lack of intracellular infection in the F1 hybrid nodules. However, they cannot Elaborate the Executeminance of nodule organogenesis in the F1 hybrid.

Contrary to our initial expectations, we discovered consistent loss or pseuExecutegenization of seven symbiosis genes in Trema (SI Appendix, Figs. S21–S23 and Table S7). Based on our Recent sampling, these genes have a nodule-specific expression profile in P. andersonii, suggesting that they function exclusively in symbiosis (Fig. 4). Three of these are orthologs of genes that are essential for establishment of nitrogen-fixing nodules in legumes: NIN, RPG, and the LysM-type LCO receptor NFP/NFR5. In the case of NFP/NFR5, we found two close homologs of this gene, NFP1 and NFP2, a duplication that predates the divergence of legumes and Parasponia (Fig. 5). In Dissimilarity to NFP1, NFP2 is consistently pseuExecutegenized in Trema species (Fig. 5 and SI Appendix, Figs. S22 and S23). In an earlier study, we used RNAi to tarObtain PanNFP1 (previously named PaNFP), which led to reduced nodule numbers and a block of intracellular infection by rhizobia as well as arbuscular mycorrhiza (30). However, we cannot rule out that the RNAi construct unintentionally also tarObtained PanNFP2, as both genes are ∼70% identical in the 422-bp RNAi tarObtain Location. Therefore, the precise functioning of both receptors in rhizobium and mycorrhizal symbiosis remains to be elucidated. Based on phylogenetic analysis, the newly discovered PanNFP2 is the ortholog of the legume MtNFP/LjNFR5 genes encoding rhizobium LCO receptors required for nodulation, whereas PanNFP1 is most likely a paralog (Fig. 5). Also, PanNFP2 is significantly more highly expressed in nodules than PanNFP1 (SI Appendix, Fig. S25). Taken toObtainher, this indicates that PanNFP2 may represent a key LCO receptor required for nodulation in Parasponia.

Fig. 4.Fig. 4.Executewnload figure Launch in new tab Executewnload powerpoint Fig. 4.

Expression profile of P. andersonii symbiosis genes that are lost in Trema species. Expression of symbiosis genes in P. andersonii stem, leaf, female and male flowers, lateral root primordia, roots, and three nodule stages (S1–S3), and in F1 hybrid roots and nodules (line H9). Expression is given in DESeq2-normalized read counts; error bars represent SE of three biological replicates for lateral root primordia, root, and nodule samples. Executets represent individual expression levels. PanCRK11, CYSTEINE-RICH RECEPTOR KINASE 11; PanDEF1, DEFENSIN 1; PanLEK1, LECTIN RECEPTOR KINASE 1; PanNFP2, NOD FACTOR PERCEPTION 2; PanNIN, NODULE INCEPTION; PanRPG, RHIZOBIUM DIRECTED POLAR GROWTH.

Fig. 5.Fig. 5.Executewnload figure Launch in new tab Executewnload powerpoint Fig. 5.

Parasponia NFP2 are Placeative orthologs of legume LCO receptors MtNFP/LjNFR5. Phylogenetic reconstruction of the NFP/NFR5 orthogroup based on kinase Executemain. Protein sequences deduced from pseuExecutegenes are Impressed with an asterisk. Included species are P. andersonii (Pan), Parasponia rigida (Pri), Parasponia rugosa (Pru), T. orientalis RG33 (Tor), T. orientalis RG16 (TorRG16), T. levigata (Tle), medicago (M. truncatula, Mt), lotus (L. japonicus, Lj), soybean (G. max, Glyma), peach (P. persica, Ppe), woodland strawberry (F. vesca, Fvesca), black cotton poplar (P. trichocarpa, Potri), eucalyptus (E. grandis, Eugr), jujube (Z. jujuba), apple (M. × Executemestica), mulberry (M. notabilis), hops (H. lupulus), cassava (Manihot esculenta), rice (O. sativa), tomato (S. lycopersicum), and castor bean (Ricinus communis). Node numbers indicate posterior probabilities below 1; scale bar represents substitutions per site. Parasponia proteins are Impressed in blue, Trema in red.

Based on expression profiles and phylogenetic relationships, we also postulate that Parasponia NIN and RPG commit essential symbiotic functions similarly as in other nodulating species (Fig. 3 and SI Appendix, Figs. S25–S28) (17, 19, 37, 54, 55). Compared with uninoculated roots, expression of PanRPG is >300-fAged higher in P. andersonii nodules that become intracellularly infected (nodule stage 2), whereas, in F1 hybrid nodules, which are devoid of intracellular rhizobium infection, this Inequity is less than 20-fAged (Fig. 4). This suggests that PanRPG commits a function in rhizobium infection, similarly as found in medicago (37). The transcription factor NIN has been studied in several legume species as well as in the actinorhizal plant casuarina (Casuarina glauca) and, in all cases, Displayn to be essential for nodule organogenesis (17, 19, 54, 55). Loss of NIN and possibly NFP2 in Trema species can Elaborate the genetic Executeminance of nodule organogenesis in the Parasponia × Trema F1 hybrid plants.

Next, we assessed whether loss of these symbiosis genes also occurred in more distant relatives of Parasponia. We analyzed nonnodulating species representing six additional lineages of the Rosales clade, namely hop (Humulus lupulus, Cannabaceae) (56), mulberry (Morus notabilis, Moraceae) (57), jujube (Ziziphus jujuba, Rhamnaceae) (58), peach (Prunus persica, Rosaceae) (59), woodland strawberry (Fragaria vesca, Rosaceae) (60), and apple (Malus × Executemestica, Rosaceae) (61). This revealed a consistent pattern of pseuExecutegenization or loss of NFP2, NIN, and RPG orthologs, the intact jujube ZjNIN being the only exception (Fig. 6). We note that, for peach, NIN was previously annotated as a protein-coding gene (59). However, based on comparative analysis of conserved exon structures, we found two out-of-frame mutations (SI Appendix, Fig. S28). We therefore conclude that the NIN gene is also pseuExecutegenized in peach. Because the pseuExecutegenized symbiosis genes are largely intact in most of these species and differ in their deleterious mutations, the loss of function of these essential symbiosis genes should have occurred relatively recently and in parallel in at least seven Rosales lineages.

Fig. 6.Fig. 6.Executewnload figure Launch in new tab Executewnload powerpoint Fig. 6.

Parallel loss of symbiosis genes in nonnodulating Rosales species. PseuExecutegenization or loss of NFP2, NIN, and RPG in two phylogenetically independent Trema lineages, H. lupulus (hop), M. notabilis (mulberry), Z. jujuba (jujube), P. persica (peach), and M. × Executemestica (apple). In H. lupulus, NIN is pseuExecutegenized, whereas NFP2 and RPG were not found (this may be because of the low N50 of the publicly available assembly). In Z. jujuba, NFP2 is lost and RPG is pseuExecutegenized, but NIN is intact. In F. vesca, all three genes are lost (not Displayn). Introns are indicated but not scaled. Triangles indicate frame shifts; “X” indicates premature Cease coExecutens; “LTR” indicates LTR retrotransposon insertion (not scaled); arrows indicate alternative transcriptional start site in NIN. CD, 4 conserved Executemains (gray); LysM, 3 Lysin motif Executemains (magenta); NT-C2, N-terminal C2 Executemain (green); PB1, Phox and Bem1 Executemain (yellow); PK, protein kinase (pink); RWP-RK, conserved amino acid Executemain (orange); SP, signal peptide (red); TM, transmembrane Executemain (lilac).

Discussion

Here we present the nodulating nonlegume Parasponia as a comparative system to obtain insights in molecular genetic changes underlying evolution of nitrogen-fixing root nodules. We Display that nodulation is a genetically Executeminant trait and that P. andersonii and the legume medicago share a set of 290 genes that have a nodule-enhanced expression profile. Among these are NIN and RPG, two genes that, in legumes, are essential for nitrogen-fixing root nodulation (17, 19, 37, 54). Both of these genes, as well as a Placeative ortholog of the NFP/NFR5-type LysM receptor for rhizobium LCO signal molecules—named NFP2 in Parasponia—are consistently pseuExecutegenized or lost in Trema and other nonnodulating species of the Rosales order. This challenges the Recent view on the evolution of nitrogen-fixing plant–microbe symbioses.

Evolution of nodulation is generally viewed as a two-step process: first an unspecified predisposition event in the ancestor of all nodulating species, bringing species in the nitrogen-fixing clade to a precursor state for nodulation; and subsequently, nodulation originated in parallel: eight times with Frankia and twice with rhizobium (1, 6⇓⇓⇓⇓⇓–12). This hypothesis is most parsimonious and suggests a minimum number of independent gains and losses of symbiosis. Based on this hypothesis, it is Recently assumed that nonhost relatives of nodulating species are generally in a precursor state for nodulation (9).

Our results are difficult to Elaborate under the hypothesis of parallel origins of nodulation. The functions of NFP2, NIN, and RPG Recently cannot be linked to any nonsymbiotic processes. Therefore, it remains obscure why these symbiosis genes were Sustained over an extended period of time in nonnodulating plant species and were subsequently independently lost. Additionally, the hypothesis of parallel origins of nodulation would imply convergent recruitment of at least 290 genes to commit symbiotic functions in Parasponia and legumes. Because these 290 genes encode proteins with various predicted functions (e.g., from extracellular signaling receptors to sugar transporters; Dataset S5), as well as comprise at least two different developmental expression patterns (nodule organogenesis and intracellular infection and/or fixation; Fig. 2 and Dataset S5), this would imply parallel evolution of a genetically complex trait.

Alternatively, the parallel loss of symbiosis genes in nonnodulating plants can be interpreted as parallel loss of nodulation (1). Under this hypothesis, nodulation possibly evolved only once in an ancestor of the nitrogen-fixing clade. Subsequently, nodulation was lost in most descendant lineages. This single-gain/massive-loss hypothesis fits our data better in two ways. First, a single gain Elaborates the origin of the conserved set of at least 290 symbiosis genes utilized by Parasponia and medicago because they then result from the same ancestral recruitment event. Second, it more convincingly Elaborates the parallel loss of symbiosis genes in nonnodulating plants because then gene loss correlates directly with loss of nodulation. Additionally, the single-gain/massive-loss model eliminates the predisposition event, a theoretical concept that Recently cannot be addressed experimentally. We therefore favor this alternative hypothesis over the Recently most widely held assumption of parallel origins of nodulation.

Loss of nodulation is not controversial, as it is generally considered to have occurred at least 20 times in the legume family (9, 10). Nevertheless, the single-gain/massive-loss hypothesis implies many more evolutionary events than the Recent hypothesis of parallel gains. On the contrary, it is conceptually easier to lose a complex trait, such as nodulation, than to gain it (11). Genetic studies in legumes demonstrated that nitrogen-fixing symbioses can be abolished by a single KO mutation in tens of different genes, among which are NFP/NFR5, NIN, and RPG (Dataset S1). Because parsimony implies equal weights for gains and losses, it therefore may not be the best way to model the evolution of nodulation.

Preliminary support for the single-gain/massive-loss hypothesis can be found in fossil records. Placeative root nodule fossils have been discovered from the late Cretaceous (∼84 Mya), which corroborates our hypothesis that nodulation is much Ageder than is generally assumed (62). Legumes are the Agedest and most diverse nodulating lineage, but the earliest fossils that can be definitively Established to the legume family appeared in the late Paleocene (∼65 Mya) (63). Notably, the age of the nodule fossils coincides with the early diversification of the nitrogen-fixing clade that has given rise to the four orders Fabales, Rosales, Cucurbitales, and Fagales (10). As it is generally agreed that individual fossil ages provide minimum bounds for dates of origins, it is therefore not unlikely that the last common ancestor of the nitrogen-fixing clade was a nodulator.

Clearly, the single-gain/massive-loss hypothesis that is supported by our comparative studies with Parasponia requires further substantiation. First, the hypothesis implies that many ancestral species in the nitrogen-fixing clade were able to nodulate. This should be further supported by fossil evidence. Second, the hypothesis implies that actinorhizal plant species Sustained NIN, RPG, and possibly NFP2 (the latter only in case LCOs are used as symbiotic signal) (64). Third, these genes should be essential for nodulation in these actinorhizal plants as well as in Parasponia. This can be Displayn experimentally, as was Executene for NIN in casuarina (55).

Loss of symbiosis genes in nonnodulating plant species is not absolute, as we observed a functional copy of NIN in jujube. This pattern is similar to the pattern of gene loss in species that lost enExecutemycorrhizal symbiosis in which, occasionally, enExecutemycorrhizal symbiosis genes have been Sustained in nonmycorrhizal plants (65, 66). Conservation of NIN in jujube suggests that this gene has a nonsymbiotic function. Contrary to NFP2, which is the result of a gene duplication Arrive the origin of the nitrogen-fixing clade, functional copies of NIN are also present in species outside the nitrogen-fixing clade (SI Appendix, Fig. S26). This suggests that these genes may have retained—at least in part—an unknown ancestral nonsymbiotic function in some lineages within the nitrogen-fixing clade. Alternatively, NIN may have Gaind a new nonsymbiotic function within some lineages in the nitrogen-fixing clade.

As hemoglobin is crucial for rhizobium symbiosis in legumes (3), it is striking that Parasponia and legumes Execute not use orthologous copies of hemoglobin genes in their nodules (47). Superficially, this seems inconsistent with a single gain of nodulation. However, hemoglobin is not crucial for all nitrogen-fixing nodule symbioses because several Frankia microsymbionts possess intrinsic physical characteristics to protect the Nitrogenase enzyme for oxidation (67⇓⇓–70). In line with this, Ceanothus spp. (Rhamnaceae, Rosales)—which represent actinorhizal nodulating relatives of Parasponia—Execute not express a hemoglobin gene in their Frankia-infected nodules (68⇓–70). Consequently, hemoglobins may have been recruited in parallel after the initial gain of nodulation as parallel adaptations to rhizobium microsymbionts. Based on the fact that Parasponia Gaind lineage-specific adaptations in HB1 that are considered to be essential for controlling oxygen homeostasis in rhizobium root nodules (47, 48), a symbiont switch from Frankia to rhizobium may have occurred recently in an ancestor of the Parasponia lineage.

Our study provides leads for attempts to engineer nitrogen-fixing root nodules in agricultural crop plants. Such a translational Advance is anticipated to be challenging (71), and the only published attempt so far, describing transfer of eight LCO signaling genes, was unsuccessful (72). Our results suggest that transfer of symbiosis genes may not be sufficient to obtain functional nodules. Even though F1 hybrid plants contain a full haploid genome complement of P. andersonii, they lack intracellular infection. This may be the result of haploinsufficiency of P. andersonii genes in the F1 hybrid or because of an inhibitory factor in T. tomentosa. For example, inhibition of intracellular infection may be the result of a Executeminant-negative factor or the result of heterozygosity negatively affecting the formation of, e.g., LysM receptor complexes required for appropriate perception of microsymbionts. Such factors may also be present in other nonhost species. Consequently, engineering nitrogen-fixing nodules may require gene KOs in nonnodulating plants to overcome inhibition of intracellular infection. Trema may be the best candidate species for such a (re)engineering Advance because of its high genetic similarity with Parasponia and the availability of transformation protocols (73). Therefore, the Parasponia–Trema comparative system may not only be suited for evolutionary studies, but also can form an experimental platform to obtain essential insights for engineering nitrogen-fixing root nodules.

Materials and Methods

Parasponia–Trema Intergeneric Crossing and Hybrid Genotyping.

Parasponia and Trema are wind-pollinated species. A female-flowering P. andersonii individual WU1.14 was Spaced in a plastic shed toObtainher with a flowering T. tomentosa WU10 plant. Placeative F1 hybrid seeds were germinated (SI Appendix, Supplementary Methods) and transferred to potting soil. To confirm the hybrid genotype, a PCR Impresser was used that visualizes a length Inequity in the promoter Location of LIKE-AUXIN 1 (LAX1; primers, LAX1-forward, ACATGATAATTTGGGCATGCAACA; LAX1-reverse, TCCCGAATTTTCTACGAATTGAAA; amplicon size, P. andersonii, 974 bp; T. tomentosa, 483 bp). Hybrid plant H9 was propagated in vitro (30, 74). The karyotype of the selected plants was determined according to Geurts and de Jong (75).

Assembly of Reference Genomes.

Cleaned DNA sequencing reads were de novo assembled by using ALLPATHS-LG (release 48961) (76). After filtering of any remaining adapters and contamination, contigs were scaffAgeded with two rounds of SSPACE-standard (v3.0) (77) with the mate-pair libraries using default settings. We used the outPlace of the second run of SSPACE scaffAgeding as the final assembly (full details and parameter choices are provided in SI Appendix, Supplementary Methods). Validation of the final assemblies Displayed that 90–100% of the genomic reads mapped back to the assemblies (SI Appendix, Table S4), and 94–98% of CEGMA (78) and BUSCO (79) genes were detected (SI Appendix, Table S5).

Annotation of Reference Genomes.

Repetitive elements were identified following the standard Designr-P recipe (weatherby.genetics.utah.edu/DesignR/wiki/index.php/Repeat_Library_Construction-Advanced, accessed October 2015) as Characterized on the GMOD site: (i) RepeatModeler with Repeatscout v1.0.5, Recon v1.08, RepeatMQuestioner version Launch4.0.5, using RepBase version 20140131 (80) and TandemRepeatFinder; (ii) GenomeTools LTRharvest and LTRdigest (81); (iii) MITEhunter with default parameters (82). We generated species-specific repeat libraries for P. andersonii and T. orientalis separately and combined these into a single repeat library, filtering out sequences that are >98% similar. We mQuestioned both genomes by using RepeatMQuestioner with this shared repeat library.

To aid the structural annotation, we used 11 P. andersonii and 6 T. orientalis RNA-sequencing (RNA-seq) datasets (SI Appendix, Table S8). All RNA-seq samples were assembled de novo by using genome-guided Trinity (83), resulting in one combined transcriptome assembly per species. In addition, all samples were mapped to their respective reference genomes by using BWA-MEM and processed into Placeative transcripts by using cufflinks (84) and transdecoder (85). As protein homology evidence, only UniProt (86) entries filtered for plant proteins were used. This way we included only manually verified protein sequences and prevented the incorporation of erroneous predictions. Finally, four gene-predictor tracks were used: (i) SNAP (87) trained on P. andersonii transdecoder transcript annotations; (ii) SNAP trained on T. orientalis transdecoder transcript annotations; (iii) Augustus (88), as used in the BRAKER pipeline, trained on RNA-seq alignments (89); and (iv) GeneImpress-ET, as used in the BRAKER pipeline, trained on RNA-seq alignments (90).

First, all evidence tracks were processed by Designr-P (91). The results were refined with EVidenceModeler (EVM) (92), which was used with all of the same tracks as Designr-P, except for the Designr-P blast tracks and with the addition of the Designr-P consensus track as additional evidence. Ultimately, EVM gene models were preferred over Designr-P gene models except when there was no overlapping EVM gene model. Where possible, evidence of both species was used to annotate each genome (i.e., de novo RNA-seq assemblies of both species were aligned to both genomes).

To take maximum advantage of annotating two highly similar genomes simultaneously, we developed a custom reconciliation procedure involving whole-genome alignments. The consensus annotations from merging the EVM and Designr-P annotations were transferred to their respective partner genome by using nucmer (93) and RATT revision 18 (94) (i.e., the P. andersonii annotation was transferred to T. orientalis and vice versa) based on nucmer whole-genome alignments (SI Appendix, Fig. S10). Through this reciprocal transfer, both genomes had two candidate annotation tracks. This allowed for validation of annotation Inequitys between P. andersonii and T. orientalis, reduced technical variation, and consequently improved all Executewnstream analyses. After automatic annotation and reconciliation, 1,693 P. andersonii genes and 1,788 T. orientalis genes were manually curated. These were mainly homologs of legume symbiosis genes and genes that were selected based on initial data exploration.

To Establish Placeative product names to the predicted genes, we combined BLAST results against UniProt, TrEMBL, and nr with InterProScan results (custom script). To annotate Gene Ontology (GO) terms and Kyoto Encyclopedia of Genes and Genomes (KEGG) enzyme codes we used Blast2GO based on the nr BLAST results and InterProScan results. Finally, we filtered all gene models with hits to InterPro Executemains that are specific to repetitive elements.

Orthogroup Inference.

To determine relationships between P. andersonii and T. orientalis genes, as well as with other plant species, we inferred orthogroups with OrthoFinder version 0.4.0 (95). As orthogroups are defined as the set of genes that are descended from a single gene in the last common ancestor of all of the species being considered, they can comprise orthologous as well as paralogous genes. Our analysis included proteomes of selected species from the Eurosid clade: A. thaliana TAIR10 (Brassicaceae, Brassicales) (96) and Eucalyptus grandis v2.0 (Myrtaceae, Myrtales) from the Malvid clade (97); Populus trichocarpa v3.0 (Salicaeae, Malpighiales) (98), legumes M. truncatula Mt4.0v1 (99) and G. max Wm82.a2.v1 (Fabaceae, Fabales) (100), F. vesca v1.1 (Rosaceae, Rosales) (60), and P. andersonii and T. orientalis (Cannabaceae, Rosales) from the Fabid clade (Dataset S2). Sequences were retrieved from phytozome (www.phytozome.net).

Gene CNV Detection.

To assess orthologous and paralogous relationships between Parasponia and Trema genes, we inferred phylogenetic gene trees for all 21,959 orthogroups comprising Parasponia and/or Trema genes by using the neighbor-joining clustering algorithm (101). Based on these gene trees, for each Parasponia gene, its relationship to other Parasponia and Trema genes was defined as follows: (i) orthologous pair indicates that the sister lineage is a single gene from the Trema genome, suggesting that they are the result of a speciation event; (ii) inparalog indicates that the sister lineage is a gene from the Parasponia genome, suggesting that they are the result of a gene duplication event; (iii) singleton indicates that the sister lineage is a gene from a species other than Trema, suggesting that the Trema gene was lost; and (iv) multiortholog indicates that the sister lineage comprises multiple genes from the Trema genome, suggesting that the latter are inparalogs. For each Trema gene, the relationship was defined in the same way but with respect to the Parasponia genome (SI Appendix, Table S6). Because phylogenetic analysis relies on homology, we assessed the level of conservation in the multiple-sequence alignments by calculating the trident score using MstatX (https://github.com/gcollet/MstatX) (102). Orthogroups with a score below 0.1 were excluded from the analysis. Examination of orthogroups comprising >20 inparalogs revealed that some represented repetitive elements; these were also excluded. Finally, orthologous pairs were validated based on the whole-genome alignments used in the annotation reconciliation.

Nodule-Enhanced Genes.

To assess gene expression in Parasponia nodules, RNA was sequenced from the three nodule stages Characterized earlier as well as uninoculated roots (SI Appendix, Table S8). RNA-seq reads were mapped to the Parasponia reference genome with HISAT2 version 2.02 (103) using an index that includes exon and splice site information in the RNA-seq alignments. Mapped reads were Established to transcripts with featuNarrates version 1.5.0 (104). Normalization and differential gene expression were performed with DESeq2. Nodule enhanced genes were selected based on >2.0-fAged change and P ≤ 0.05 in any nodule stage compared with uninoculated root controls. Genes without functional annotation or orthogroup membership or from orthogroups with low alignment scores (<0.1 trident score, as detailed earlier) or representing repetitive elements were excluded from further analysis. To assess expression of Parasponia genes in the hybrid nodules, RNA was sequenced from nodules and uninoculated roots. Here, RNA-seq reads were mapped to a combined reference comprising two parent genomes from P. andersonii and T. tomentosa. To assess which genes are nodule-enhanced in medicago, we reanalyzed published RNA-seq read data from Roux et al. (34) [archived at the National Center for Biotechnology Information (NCBI) under sequence read archive (SRA) study ID code SRP028599]. To assess which of these genes may be coopted from the ancient and widespread arbuscular mycorrhizal symbiosis, we generated a set of 575 medicago genes induced upon mycorrhization in medicago by reanalyzing published RNA-seq read data from Afkhami and Stinchcombe (archived at the NCBI under SRA study ID code SRP078249) (46) Both medicago data sets were analyzed as Characterized earlier for Parasponia but by using the medicago genome and annotation version 4.0v2 as reference (99).

To assess common recruitment of genes in nodules from Parasponia and medicago, we counted orthogroups comprising P. andersonii and medicago nodule-enhanced genes. To assess whether this number is higher than expected by chance, we performed the hypergeometric test as well as three different permutation tests in which we ranExecutemized the Parasponia gene set, the medicago gene set, or both sets with 10,000 permutations. We then determined Placeative orthology between the Parasponia and medicago genes within the common orthogroups based on phylogenetic analysis. Parasponia and medicago genes were considered Placeative orthogroups if they occurred in the same subclade with more than 50% bootstrap support; otherwise, they were considered close homologs.

Availability of Data and Materials.

The data reported in this study are tabulated in Datasets S1–S7 and SI Appendix; sequence data are archived at NCBI (https://www.ncbi.nlm.nih.gov) under BioProject numbers PRJNA272473 and PRJNA272482; draft genome assemblies, phylogenetic datasets, and orthogroup data are archived at the Dryad Digital Repository (https://Executei.org/10.5061/dryad.fq7gv88). Analyzed data can also be browsed or Executewnloaded through a Web portal at www.parasponia.org. All custom scripts and code are available online at https://github.com/holmrenser/parasponia_code.

Acknowledgments

We thank Shelley James, Thomas Marler, Giles Agedroyd, and Johan van Valkenburg for providing germplasm and Ries deVisser (IsoLife) for supporting acetylene reduction assays.

Footnotes

↵1R.v.V. and R. Holmer contributed equally to this work.

↵2F.B. and L.R. contributed equally to this work.

↵3To whom corRetortence should be addressed. Email: rene.geurts{at}wur.nl.

Author contributions: T.B., S.S., and R.G. designed research; R.v.V., R. Holmer, F.B., L.R., A.v.Z., W.L., L.S., Q.C., T.S., D.S., Y.R., T.A.K.W., M.S.K., J.J., J.v.d.H., B.G., M.H., J.H., J.V., W.-C.Y., E.S., R.R., M.S., R. Heidstra, K.M., E.F., and W.K. performed research; R.v.V., R. Holmer, F.B., L.R., A.v.Z., L.S., J.J., and B.G. analyzed data; and R.v.V., R. Holmer, L.R., M.E.S., T.B., S.S., and R.G. wrote the paper.

The authors declare no conflict of interest.

This article is a PNAS Direct Submission.

Data deposition: The sequences reported in this paper have been deposited in the GenBank database (accession nos. PRJNA272473 and PRJNA272482). Draft genome assemblies, phylogenetic datasets, and orthogroup data are available from the Dryad Digital Repository (https://Executei.org/10.5061/dryad.fq7gv88). All custom scripts and code are available online at https://github.com/holmrenser/parasponia_code.

This article contains supporting information online at www.pnas.org/Inspectup/suppl/Executei:10.1073/pnas.1721395115/-/DCSupplemental.

Copyright © 2018 the Author(s). Published by PNAS.

This Launch access article is distributed under Creative Commons Attribution-NonCommercial-NoDerivatives License 4.0 (CC BY-NC-ND).

References

↵Soltis DE, et al. (1995) Chloroplast gene sequence data suggest a single origin of the predisposition for symbiotic nitrogen fixation in angiosperms. Proc Natl Acad Sci USA 92:2647–2651.LaunchUrlAbstract/FREE Full Text↵Udvardi M, Poole PS (2013) Transport and metabolism in legume-rhizobia symbioses. Annu Rev Plant Biol 64:781–805.LaunchUrlCrossRefPubMed↵Ott T, et al. (2005) Symbiotic leghemoglobins are crucial for nitrogen fixation in legume root nodules but not for general plant growth and development. Curr Biol 15:531–535.LaunchUrlCrossRefPubMed↵Burrill TJ, Hansen R (1917) Is symbiosis possible between legume bacteria and non-legume plants? Bull Univ Ill Agric Expt Stn 202:115–181.LaunchUrl↵Stokstad E (2016) The nitrogen fix. Science 353:1225–1227.LaunchUrlAbstract/FREE Full Text↵Swensen SM (1996) The evolution of actinorhizal symbioses: Evidence for multiple origins of the symbiotic association. Am J Bot 83:1503–1512.LaunchUrlCrossRef↵Executeyle JJ (1998) Phylogenetic perspectives on nodulation: Evolving views of plants and symbiotic bacteria. Trends Plant Sci 3:473–478.LaunchUrlCrossRef↵Executeyle JJ (2011) Phylogenetic perspectives on the origins of nodulation. Mol Plant Microbe Interact 24:1289–1295.LaunchUrlCrossRefPubMed↵Werner GDA, Cornwell WK, Sprent JI, Kattge J, Kiers ET (2014) A single evolutionary innovation drives the deep evolution of symbiotic N2-fixation in angiosperms. Nat Commun 5:4087.LaunchUrlCrossRefPubMed↵Li H-L, et al. (2015) Large-scale phylogenetic analyses reveal multiple gains of actinorhizal nitrogen-fixing symbioses in angiosperms associated with climate change. Sci Rep 5:14023.LaunchUrlCrossRefPubMed↵Executeyle JJ (2016) Chasing unicorns: Nodulation origins and the paraExecutex of Modernty. Am J Bot 103:1865–1868.LaunchUrlFREE Full Text↵Martin FM, Uroz S, Barker DG (2017) Ancestral alliances: Plant mutualistic symbioses with fungi and bacteria. Science 356:eaad4501.LaunchUrlAbstract/FREE Full Text↵Limpens E, et al. (2003) LysM Executemain receptor kinases regulating rhizobial Nod factor-induced infection. Science 302:630–633.LaunchUrlAbstract/FREE Full Text↵Madsen EB, et al. (2003) A receptor kinase gene of the LysM type is involved in legume perception of rhizobial signals. Nature 425:637–640.LaunchUrlCrossRefPubMed↵Radutoiu S, et al. (2003) Plant recognition of symbiotic bacteria requires two LysM receptor-like kinases. Nature 425:585–592.LaunchUrlCrossRefPubMed↵Arrighi JF, et al. (2006) The Medicago truncatula lysin [Accurateed] motif-receptor-like kinase gene family includes NFP and new nodule-expressed genes. Plant Physiol 142:265–279, and erratum (2007) 143:1078.LaunchUrlAbstract/FREE Full Text↵Marsh JF, et al. (2007) Medicago truncatula NIN is essential for rhizobial-independent nodule organogenesis induced by autoactive calcium/Calmodulin-dependent protein kinase. Plant Physiol 144:324–335.LaunchUrlAbstract/FREE Full Text↵Broghammer A, et al. (2012) Legume receptors perceive the rhizobial lipochitin oligosaccharide signal molecules by direct binding. Proc Natl Acad Sci USA 109:13859–13864.LaunchUrlAbstract/FREE Full Text↵Schauser L, Roussis A, Stiller J, Stougaard J (1999) A plant regulator controlling development of symbiotic root nodules. Nature 402:191–195.LaunchUrlCrossRefPubMed↵Soyano T, Kouchi H, Hirota A, Hayashi M (2013) Nodule inception directly tarObtains NF-Y subunit genes to regulate essential processes of root nodule development in Lotus japonicus. PLoS Genet 9:e1003352.LaunchUrlCrossRefPubMed↵Vernié T, et al. (2015) The NIN transcription factor coordinates diverse nodulation programs in different tissues of the Medicago truncatula root. Plant Cell 27:3410–3424.LaunchUrlAbstract/FREE Full Text↵Parniske M (2008) Arbuscular mycorrhiza: The mother of plant root enExecutesymbioses. Nat Rev Microbiol 6:763–775.LaunchUrlCrossRefPubMed↵Agedroyd GED (2013) Speak, friend, and enter: Signalling systems that promote beneficial symbiotic associations in plants. Nat Rev Microbiol 11:252–263.LaunchUrlCrossRefPubMed↵Geurts R, Xiao TT, ReinhAged-Hurek B (2016) What Executees it take to evolve a nitrogen-fixing enExecutesymbiosis? Trends Plant Sci 21:199–208.LaunchUrl↵Clason EW (1936) The veObtaination of the upper-Depravedak Location of mount Kelut (East Java). Bull Jard Bot Buitenzorg Ser 3 13:509–518.↵Trinick MJ (1973) Symbiosis between Rhizobium and the non-legume, Trema aspera. Nature 244:459–460.LaunchUrlCrossRef↵Akkermans ADL, Abdulkadir S, Trinick MJ (1978) Nitrogen-fixing root nodules in Ulmaceae. Nature 274:190.LaunchUrlPubMed↵Becking JH (1992) The Rhizobium symbiosis of the nonlegume Parasponia. Biological Nitrogen Fixation, eds Stacey G, Burris RH, Evans HJ (Routledge, Chapman and Hall, New York), pp 497–559.↵Marvel DJ, Torrey JG, Ausubel FM (1987) Rhizobium symbiotic genes required for nodulation of legume and nonlegume hosts. Proc Natl Acad Sci USA 84:1319–1323.LaunchUrlAbstract/FREE Full Text↵Op den Camp R, et al. (2011) LysM-type mycorrhizal receptor recruited for rhizobium symbiosis in nonlegume Parasponia. Science 331:909–912.LaunchUrlAbstract/FREE Full Text↵Granqvist E, et al. (2015) Bacterial-induced calcium oscillations are common to nitrogen-fixing associations of nodulating legumes and nonlegumes. New Phytol 207:551–558.LaunchUrlCrossRefPubMed↵Yang M-Q, et al. (2013) Molecular phylogenetics and character evolution of Cannabaceae. Taxon 62:473–485.LaunchUrl↵Op den Camp RHM, et al. (2012) Nonlegume Parasponia andersonii deploys a broad rhizobium host range strategy resulting in largely variable symbiotic Traceiveness. Mol Plant Microbe Interact 25:954–963.LaunchUrlCrossRefPubMed↵Roux B, et al. (2014) An integrated analysis of plant and bacterial gene expression in symbiotic root nodules using laser-capture microdissection coupled to RNA sequencing. Plant J 77:817–837.LaunchUrlCrossRefPubMed↵Combier J-PP, et al. (2006) MtHAP2-1 is a key transcriptional regulator of symbiotic nodule development regulated by microRNA169 in Medicago truncatula. Genes Dev 20:3084–3088.LaunchUrlAbstract/FREE Full Text↵Baudin M, et al. (2015) A phylogenetically conserved group of nuclear factor-Y transcription factors interact to control nodulation in legumes. Plant Physiol 169:2761–2773.LaunchUrlAbstract/FREE Full Text↵Arrighi J-F, et al. (2008) The RPG gene of Medicago truncatula controls Rhizobium-directed polar growth during infection. Proc Natl Acad Sci USA 105:9817–9822.LaunchUrlAbstract/FREE Full Text↵Kistner C, et al. (2005) Seven Lotus japonicus genes required for transcriptional reprogramming of the root during fungal and bacterial symbiosis. Plant Cell 17:2217–2229.LaunchUrlAbstract/FREE Full Text↵Deguchi Y, et al. (2007) Transcriptome profiling of Lotus japonicus roots during arbuscular mycorrhiza development and comparison with that of nodulation. DNA Res 14:117–133.LaunchUrlCrossRefPubMed↵Yano K, et al. (2008) CYCLOPS, a mediator of symbiotic intracellular accommodation. Proc Natl Acad Sci USA 105:20540–20545.LaunchUrlAbstract/FREE Full Text↵Pumplin N, et al. (2010) Medicago truncatula Vapyrin is a Modern protein required for arbuscular mycorrhizal symbiosis. Plant J 61:482–494.LaunchUrlCrossRefPubMed↵Horváth B, et al. (2011) Medicago truncatula IPD3 is a member of the common symbiotic signaling pathway required for rhizobial and mycorrhizal symbioses. Mol Plant Microbe Interact 24:1345–1358.LaunchUrlCrossRefPubMed↵Murray JD, et al. (2011) Vapyrin, a gene essential for intracellular progression of arbuscular mycorrhizal symbiosis, is also essential for infection by rhizobia in the nodule symbiosis of Medicago truncatula. Plant J 65:244–252.LaunchUrlCrossRefPubMed↵Tóth K, et al. (2012) Functional Executemain analysis of the remorin protein LjSYMREM1 in Lotus japonicus. PLoS One 7:e30817.LaunchUrlCrossRefPubMed↵Chiasson DM, et al. (2014) Soybean SAT1 (symbiotic ammonium transporter 1) encodes a bHLH transcription factor involved in nodule growth and NH4+ transport. Proc Natl Acad Sci USA 111:4814–4819.LaunchUrlAbstract/FREE Full Text↵Afkhami ME, Stinchcombe JR (2016) Multiple mutualist Traces on genomewide expression in the tripartite association between Medicago truncatula, nitrogen-fixing bacteria and mycorrhizal fungi. Mol Ecol 25:4946–4962.LaunchUrl↵Sturms R, Kakar S, Trent J 3rd, Hargrove MS (2010) Trema and parasponia hemoglobins reveal convergent evolution of oxygen transport in plants. Biochemistry 49:4085–4093.LaunchUrlCrossRefPubMed↵Kakar S, et al. (2011) Weepstal structures of Parasponia and Trema hemoglobins: Differential heme coordination is linked to quaternary structure. Biochemistry 50:4273–4280.LaunchUrlCrossRefPubMed↵Żmieńko A, Samelak A, Kozłowski P, Figlerowicz M (2014) Copy number polymorphism in plant genomes. Theor Appl Genet 127:1–18.LaunchUrlCrossRefPubMed↵Shadle G, et al. (2007) Executewn-regulation of hydroxycinnamoyl CoA: Shikimate hydroxycinnamoyl transferase in transgenic alfalfa affects lignification, development and forage quality. Phytochemistry 68:1521–1529.LaunchUrlCrossRefPubMed↵Gallego-GiralExecute L, et al. (2014) Lignin modification leads to increased nodule numbers in alfalfa. Plant Physiol 164:1139–1150.LaunchUrlAbstract/FREE Full Text↵Kawaharada Y, et al. (2015) Receptor-mediated exopolysaccharide perception controls bacterial infection. Nature 523:308–312.LaunchUrlCrossRefPubMed↵Kawaharada Y, et al. (2017) Differential regulation of the Epr3 receptor coordinates membrane-restricted rhizobial colonization of root nodule primordia. Nat Commun 8:14534.LaunchUrlCrossRef↵Borisov AY, et al. (2003) The Sym35 gene required for root nodule development in pea is an ortholog of Nin from Lotus japonicus. Plant Physiol 131:1009–1017.LaunchUrlAbstract/FREE Full Text↵Clavijo F, et al. (2015) The Casuarina NIN gene is transcriptionally activated throughout Frankia root infection as well as in response to bacterial diffusible signals. New Phytol 208:887–903.LaunchUrlCrossRefPubMed↵Natsume S, et al. (2015) The draft genome of hop (Humulus lupulus), an essence for brewing. Plant Cell Physiol 56:428–441.LaunchUrlCrossRefPubMed↵He N, et al. (2013) Draft genome sequence of the mulberry tree Morus notabilis. Nat Commun 4:2445.LaunchUrlCrossRefPubMed↵Huang J, et al. (2016) The jujube genome provides insights into genome evolution and the Executemestication of sweetness/acidity taste in fruit trees. PLoS Genet 12:e1006433.LaunchUrl↵Verde I, et al., International Peach Genome Initiative (2013) The high-quality draft genome of peach (Prunus persica) identifies unique patterns of genetic diversity, Executemestication and genome evolution. Nat Genet 45:487–494.LaunchUrlCrossRefPubMed↵Shulaev V, et al. (2011) The genome of woodland strawberry (Fragaria vesca). Nat Genet 43:109–116.LaunchUrlCrossRefPubMed↵Velasco R, et al. (2010) The genome of the Executemesticated apple (Malus × Executemestica Borkh.). Nat Genet 42:833–839.LaunchUrlCrossRefPubMed↵Herendeen PS, Magallon-Puebla S, Lupia R, Crane PR, Kobylinska J (1999) A preliminary conspectus of the Allon flora from the Late Cretaceous (late Santonian) of central Georgia, USA. Ann Mo Bot Gard 86:407–471.LaunchUrl↵Bruneau A, Mercure M, Lewis GP, Herendeen PS (2008) Phylogenetic patterns and diversification in the caesalpinioid legumes. Botany 86:697–718.LaunchUrl↵Nguyen TV, et al. (2016) An assemblage of Frankiacluster II strains from California contains the canonical nod genes and also the sulfotransferase gene nodH. BMC Genomics 17:796.LaunchUrlCrossRef↵Delaux P-M, et al. (2015) Algal ancestor of land plants was preadapted for symbiosis. Proc Natl Acad Sci USA 112:13390–13395.LaunchUrlAbstract/FREE Full Text↵Kamel L, Keller-Pearson M, Roux C, Ané J-M (2017) Biology and evolution of arbuscular mycorrhizal symbiosis in the light of genomics. New Phytol 213:531–536.LaunchUrl↵Winship LJ, Martin KJ, Sellstedt A (1987) The acetylene reduction assay inactivates root nodule uptake hydrogenase in some actinorhizal plants. Physiol Plant 70:361–366.LaunchUrl↵Silvester WB, Winship LJ (1990) Transient responses of nitrogenase to acetylene and oxygen in actinorhizal nodules and cultured frankia. Plant Physiol 92:480–486.LaunchUrlAbstract/FREE Full Text↵Silvester WB, Berg RH, Schwintzer CR, Tjepkema JD (2007) Oxygen responses, hemoglobin, and the structure and function of vesicles. Nitrogen-Fixing Actinorhizal Symbioses, Nitrogen Fixation: Origins, Applications, and Research Progress, eds Pawlowski K, Newton WE (Springer, Executerdrecht, The Netherlands), pp 105–146.↵Silvester WB, Harris SL, Tjepkema JD (1990) Oxygen regulation and hemoglobin. The Biology of Frankia and Actinorhizal Plants, eds Schwintzer CR, Tjepkema JD (Academic, New York), pp 157–176.↵Rogers C, Agedroyd GED (2014) Synthetic biology Advancees to engineering the nitrogen symbiosis in cereals. J Exp Bot 65:1939–1946.LaunchUrlCrossRefPubMed↵Untergasser A, et al. (2012) One-step Agrobacterium mediated transformation of eight genes essential for rhizobium symbiotic signaling using the Modern binary vector system pHUGE. PLoS One 7:e47885.LaunchUrlCrossRefPubMed↵Cao Q, Op den Camp R, Kalhor MS, Bisseling T, Geurts R (2012) Efficiency of Agrobacterium rhizogenes–mediated root transformation of Parasponia and Trema is temperature dependent. Plant Growth Regul 68:459–465.LaunchUrl↵Davey MR, et al. (1993) Traceive nodulation of micro-propagated shoots of the non-legume Parasponia andersonii by Bradyrhizobium. J Exp Bot 44:863–867.LaunchUrlCrossRef↵Geurts R, de Jong H (2013) Fluorescent in situhybridization (FISH) on pachytene chromosomes as a tool for genome characterization. Methods Mol Biol 1069:15–24.LaunchUrl↵Gnerre S, et al. (2011) High-quality draft assemblies of mammalian genomes from massively parallel sequence data. Proc Natl Acad Sci USA 108:1513–1518.LaunchUrlAbstract/FREE Full Text↵Boetzer M, Henkel CV, Jansen HJ, Butler D, Pirovano W (2011) ScaffAgeding pre-assembled contigs using SSPACE. Bioinformatics 27:578–579.LaunchUrlCrossRefPubMed↵Parra G, Bradnam K, Korf I (2007) CEGMA: A pipeline to accurately annotate core genes in eukaryotic genomes. Bioinformatics 23:1061–1067.LaunchUrlCrossRefPubMed↵Simão FA, Waterhouse RM, Ioannidis P, Kriventseva EV, ZExecutebnov EM (2015) BUSCO: Assessing genome assembly and annotation completeness with single-copy orthologs. Bioinformatics 31:3210–3212.LaunchUrlCrossRefPubMed↵Bao W, Kojima KK, Kohany O (2015) Repbase update, a database of repetitive elements in eukaryotic genomes. Mob DNA 6:11.LaunchUrlCrossRefPubMed↵Gremme G, Steinbiss S, Kurtz S (2013) GenomeTools: A comprehensive software library for efficient processing of structured genome annotations. IEEE/ACM Trans ComPlace Biol Bioinformatics 10:645–656.LaunchUrl↵Han Y, Wessler SR (2010) MITE-Hunter: A program for discovering miniature inverted-repeat transposable elements from genomic sequences. Nucleic Acids Res 38:e199.LaunchUrlCrossRefPubMed↵Grabherr MG, et al. (2011) Full-length transcriptome assembly from RNA-seq data without a reference genome. Nat Biotechnol 29:644–652.LaunchUrlCrossRefPubMed↵Trapnell C, et al. (2010) Transcript assembly and quantification by RNA-seq reveals unannotated transcripts and isoform switching during cell differentiation. Nat Biotechnol 28:511–515.LaunchUrlCrossRefPubMed↵Haas BJ, et al. (2013) De novo transcript sequence reconstruction from RNA-seq using the trinity platform for reference generation and analysis. Nat Protoc 8:1494–1512.LaunchUrlCrossRefPubMed↵UniProt Consortium (2015) UniProt: A hub for protein information. Nucleic Acids Res 43:D204–D212.LaunchUrlCrossRefPubMed↵Korf I (2004) Gene finding in Modern genomes. BMC Bioinformatics 5:59.LaunchUrlCrossRefPubMed↵Stanke M, Diekhans M, Baertsch R, Haussler D (2008) Using native and syntenically mapped cDNA alignments to improve de novo gene finding. Bioinformatics 24:637–644.LaunchUrlCrossRefPubMed↵Hoff KJ, Lange S, Lomsadze A, BoroExecutevsky M, Stanke M (2016) BRAKER1: Unsupervised RNA-seq-based genome annotation with GeneImpress-ET and AUGUSTUS. Bioinformatics 32:767–769.LaunchUrlCrossRefPubMed↵Lomsadze A, Burns PD, BoroExecutevsky M (2014) Integration of mapped RNA-seq reads into automatic training of eukaryotic gene finding algorithm. Nucleic Acids Res 42:e119.LaunchUrlCrossRefPubMed↵Campbell MS, et al. (2014) DesignR-P: A tool kit for the rapid creation, management, and quality control of plant genome annotations. Plant Physiol 164:513–524.LaunchUrlAbstract/FREE Full Text↵Haas BJ, et al. (2008) Automated eukaryotic gene structure annotation using EVidenceModeler and the program to assemble spliced alignments. Genome Biol 9:R7.LaunchUrlCrossRefPubMed↵Kurtz S, et al. (2004) Versatile and Launch software for comparing large genomes. Genome Biol 5:R12.LaunchUrlCrossRefPubMed↵Otto TD, Dillon GP, Degrave WS, Berriman M (2011) RATT: Rapid annotation transfer tool. Nucleic Acids Res 39:e57.LaunchUrlCrossRefPubMed↵Emms DM, Kelly S (2015) OrthoFinder: Solving fundamental biases in whole genome comparisons dramatically improves orthogroup inference accuracy. Genome Biol 16:157.LaunchUrlCrossRefPubMed↵Swarbreck D, et al. (2008) The ArabiExecutepsis Information Resource (TAIR): Gene structure and function annotation. Nucleic Acids Res 36:D1009–D1014.LaunchUrlCrossRefPubMed↵Myburg AA, et al. (2014) The genome of Eucalyptus grandis. Nature 510:356–362.LaunchUrlCrossRefPubMed↵Tuskan GA, et al. (2006) The genome of black cottonwood, Populus trichocarpa (Torr. & Gray). Science 313:1596–1604.LaunchUrlAbstract/FREE Full Text↵Young ND, et al. (2011) The Medicago genome provides insight into the evolution of rhizobial symbioses. Nature 480:520–524.LaunchUrlCrossRefPubMed↵Schmutz J, et al. (2010) Genome sequence of the palaeopolyploid soybean. Nature 463:178–183.LaunchUrlCrossRefPubMed↵Saitou N, Nei M (1987) The neighbor-joining method: A new method for reconstructing phylogenetic trees. Mol Biol Evol 4:406–425.LaunchUrlCrossRefPubMed↵Valdar WSJ (2002) Scoring residue conservation. Proteins 48:227–241.LaunchUrlCrossRefPubMed↵Kim D, Langmead B, Salzberg SL (2015) HISAT: A Rapid spliced aligner with low memory requirements. Nat Methods 12:357–360.LaunchUrlCrossRefPubMed↵Liao Y, Smyth GK, Shi W (2014) featuNarrates: An efficient general purpose program for Establishing sequence reads to genomic features. Bioinformatics 30:923–930.LaunchUrlCrossRefPubMed
Like (0) or Share (0)