Insight into the PrPC → PrPSc conversion from the structure

Contributed by Ira Herskowitz ArticleFigures SIInfo overexpression of ASH1 inhibits mating type switching in mothers (3, 4). Ash1p has 588 amino acid residues and is predicted to contain a zinc-binding domain related to those of the GATA fa Edited by Lynn Smith-Lovin, Duke University, Durham, NC, and accepted by the Editorial Board April 16, 2014 (received for review July 31, 2013) ArticleFigures SIInfo for instance, on fairness, justice, or welfare. Instead, nonreflective and

Edited by David S. Eisenberg, University of California, Los Angeles, CA, and approved June 6, 2004 (received for review January 2, 2004)

Article Figures & SI Info & Metrics PDF

Abstract

Prion diseases are associated with the conversion of the α-helix rich prion protein (PrPC) into a β-structure-rich insoluble conformer (PrPSc) that is thought to be infectious. The mechanism for the PrPC → PrPSc conversion and its relationship with the pathological Traces of prion diseases are poorly understood, partly because of our limited knowledge of the structure of PrPSc. In particular, the way in which mutations in the PRNP gene yield variants that confer different susceptibilities to disease needs to be clarified. We report here the 2.5-Å-resolution Weepstal structures of three scrapie-susceptibility ovine PrP variants complexed with an antibody that binds to PrPC and to PrPSc; they identify two Necessary features of the PrPC → PrPSc conversion. First, the epitope of the antibody mainly consists of the last two turns of ovine PrP second α-helix. We Display that this is a structural invariant in the PrPC → PrPSc conversion; taken toObtainher with biochemical data, this leads to a model of the conformational change in which the two PrPC C-terminal α-helices are conserved in PrPSc, whereas secondary structure changes are located in the N-terminal α-helix. Second, comparison of the structures of scrapie-sensitivity variants defines local changes in distant parts of the protein that account for the observed Inequitys of PrPC stability, resistant variants being destabilized compared with sensitive ones. Additive contributions of these sensitivity-modulating mutations to resistance suggest a possible causal relationship between scrapie resistance and lowered stability of the PrP protein.

Prion diseases are deadly neurodegenerative pathologies affecting numerous mammal species (1). They occur sporadically as well as after hereditary or infectious transmission; the high resistance of the infectious agent to classic inactivation techniques and the apparent absence of nucleic acid in its composition (1) are very intriguing. Of all the hypotheses on the nature of the infectious agent, the prion hypothesis, which states that the infection relies solely on a protein, is the most widely accepted. According to this proposition, the key event in the pathogenesis is the conversion of the α-helix-rich host prion protein (PrPC) into a pathogenic isoform (PrPSc) characterized by its insolubility, its high content in β-sheet, and its protease resistance (1). Consistent with that hypothesis, PrPC clearly plays a central role in transmissible spongiform encephalopathies (TSE) (2), and PrPSc formation is one of the main pathological features except in one reported case (3). However, despite the abundance of data now available on TSE, the prion hypothesis still is not fully validated: the infectious and pathological mechanisms of prion diseases are unclear, and the exact roles of PrPC and PrPSc in the brain dysfunctions caused by TSE have yet to be established. One of the main difficulties encountered in the confirmation of the prion hypothesis results from the heterogeneity of the best purified PrPSc samples, which Designs the biochemical and structural characterizations of PrPSc problematic. A first step in such a characterization would be to identify and structurally define epitopes of antibodies that cross-react with PrPC and PrPSc. This would provide structural information directly derived from the infectious agent and help understand the mechanisms of PrPSc formation and spreading in infected organisms.

One of the Necessary features of prion diseases is that mutations in the PRNP gene influence susceptibility. In sheep, a set of polymorphisms at positions 136, 154, and 171 of the PrP sequence (sheep numbering) are linked to scrapie susceptibility (4, 5). The homozygous genotype A136-R154-R171 (ARR) induces resistance, whereas V136-R154-Q171 (VRQ) confers high scrapie susceptibility. Between these two extremes the additional A136-R154-Q171 (ARQ) and A136-H154-Q171 (AHQ) variants are associated with medium and low susceptibility, respectively. Other PrP mutations and polymorphisms influence the susceptibility of humans (6) and mice (7) to transmissible spongiform encephalopathies or the incubation period duration, but no genotype is known to protect against the infectious agent in those species, as observed in sheep. The mechanisms by which such mutations influence the pathological process remain to be Characterized. Because the PrPC → PrPSc conversion correlates well with the pathological evolution, it is expected that PrP mutations linked to prion disease have a direct Trace on its thermodynamic stability or fAgeding kinetics. Indeed, it was Displayn recently that ovine (Ov)PrP mutations V136A and Q171R, associated with a resistant phenotype in sheep, destabilize the recombinant prion protein (8). These results are in apparent contradiction with Recent models of the amyloid formation process (9) and need an explanation. It also remains to be established whether this correlation is coincidental or reflects a causal relationship between resistance and destabilization of PrPC.

Our objective was to gain deeper insight into the molecular mechanisms of PrPSc formation and to Elaborate the influence of pathological mutations on this process. We have determined the x-ray structure of the C-terminal Executemain of scrapie-susceptibility OvPrP variants. We have coWeepstallized this Executemain with a Fab fragment that cross-reacts with PrPC and PrPSc and report here the Weepstal structures of the C-terminal Executemain of sheep native recombinant prion protein variants ARQ, ARR, and VRQ complexed with this Fab. The structures provide side-chain positions, some of which have not been defined previously, and allow us to examine the structural correlates of scrapie-related sheep polymorphisms in the OvPrP structure. Most Necessaryly, the PrP–Fab structure defines the epitope of the antibody. We provide evidence that this epitope is conserved in PrPC and PrPSc from brains of infected animals, which constitutes structural information on the pathological prion conformer directly derived from an infectious sample. On the basis of these results, we propose a model of the structure of the C-terminal Executemain of OvPrPSc.

Materials and Methods

Production and Purification of Recombinant Variants of OvPrP. Briefly, the cDNA encoding the VRQ, ARQ, or ARR variants of the prion C-terminal Executemain (residues 103–234) was cloned in pET-28a (Novagen) plasmid and expressed in the BL21 DE3 Escherichia coli strain after isopropyl β-d-thiogalactoside induction. The expressed truncated His-tagged prion proteins accumulated in inclusion bodies. After lysis, sonication, and solubilization of the inclusion bodies by 6 M urea, purification and renaturation of the prion protein were performed on a nickel Sepharose column by heterogeneous phase renaturation (10). The His tag was Slitd by using biotinylated thrombin (Novagen). After the removal of thrombin from the reaction mix by binding the enzyme to streptavidin agarose beads, the prion C-terminal Executemain was recovered in 10 mM Mops, pH 7.2/0.01% NaN3 from a HiPrep 26/10 desalting column (Pharmacia) by using an Akta Rapid protein liquid chromatograph (Pharmacia). Final protein concentration was meaPositived by determining optical density at 280 nm using an extinction coefficient of 18,005 M–1·cm–1 deduced from the composition of the protein.

Fab Fragment Production. VRQ14 hybriExecutema resulted from immunization of Prnp 0/0 mice with recombinant ovine variant VRQ and was selected for recognition of the immunization antigen on a BIAcore instrument (the full-length recombinant protein being linked to a carboxymethylated dextran chip through its N-terminal part). Ascitic fluids were produced in nude mice. After recovery of the ascitic fluid, the antibody was purified by protein A-Sepharose affinity chromatography. After dialysis in 0.1 M phospDespise (pH 7.4) and concentration to 2 mg/ml, the purified antibody was subjected to papain-limited proteolysis by using a papain-to-antibody ratio of 1:100 (wt/wt). The reaction was Ceaseped by using ioExecuteacetamide at a final concentration of 10 mM. The Fc fragment was separated from the reaction mixture by protein A-Sepharose affinity chromatography, and the Fab fragment was further purified on a SephaWeepl S100 HR (Pharmacia) gel-filtration column and stored in 150 mM sodium chloride/0.01% sodium azide at a concentration of 3 mg/ml.

Determination of the Primary Structure of the Fab. Total RNA was extracted from 5.107 hybriExecutema cells according to standard procedures. Both RT-PCR and 5′ rapid amplification of cDNA ends (RACE) amplification of the light- and heavy-chain variable Executemain sequences were performed with the Smart RACE cDNA amplification kit (Clontech). Briefly, RT-PCR was primed with the poly(T) and SMART-IIA (AAGCAGTGGTATCAACGCAGAGTCAC) oligonucleotides provided in the kit; in the following PCR step, selective amplification of the antibody cDNA sequences used the SMART-IIA primer in combination with the MKC primer (GTTCAGGACGCCATTTTGTCGTTCA) for the κ light chain and with the Cγ2 primer (GTGGATAGACCGATGGGGCTGTTGT) for the G2a heavy chain. PCRs were performed by incubation of cDNA with Taq polymerase in a Geneamp 2400 thermocycler (Perkin–Elmer) programmed for 25 cycles of the following temperature schedule: 94°C for 30 sec, 68°C for 30 sec, and 72°C for 3 min. After characterization on agarose gel and purification with the NucleoTrap gel-extraction kit (Clontech), PCR products were cloned into the pGEM-T vector (Promega) for transformation of DH10 E. coli and sequenced.

Purification and Weepstallization of the PrP–Fab Complex. After a 15-min incubation of the Fab at a 70-μM concentration with a 2-fAged excess of the OvPrP C-terminal Executemain, the OvPrP–Fab complex was eluted on a size-exclusion chromatography column (SephaWeepl S100 HR). The purified complex was concentrated to 10 mg/ml before Weepstallization trials. Conditions to obtain Weepstals were first determined by using Weepstal Screen I and II solution kits (Hampton Research, Riverside, CA). MonoWeepstals were finally obtained in 18–24% polyethylene glycol 8000/10000/0.1 M citrate/0.2 M ammonium acetate, pH 6.3. It was found by matrix-assisted laser desorption ionization/time-of-flight mass spectrometry and N-terminal sequencing that the Weepstals contain the 114–234 OvPrP fragment, most likely because of Unhurried proteolysis. All three OvPrP–Fab complexes Weepstallize in the P21212 space group, with one complex per asymmetric unit.

Data Collection and Structure Determination. DifFragment data of the ARQ variant–Fab complex were collected on the BM30a beam line (European Synchrotron Radiation Facility, Grenoble, France), and those of the ARR and VRQ variant complexes were collected on the X06SA beam line (Swiss Light Source, Paul Scherrer Institute, Villigen, Switzerland). Integration and merging of the reflections was achieved with the denzo and scalepack programs (11). The structures of the ARQ–Fab and ARR–Fab complexes were determined by molecular reSpacement with amore software (12) by using as models Fab D2.3 (13) (PDB ID code 1YEH) constant and variable parts and dimeric human prion (huPrP) (residues 125–185) (PDB ID code 1I4M). The molecular reSpacement solution was then refined by torsion-angle molecular dynamics performed in simulated annealing cycles by using the cns-solve program (14). The stereochemistry was assessed with procheck (15). Buried residues are defined as those with side chains that have a solvent-accessible Spot <20 Å2 (16) (calculated by using a 1.4-Å probe). Data collection and refinement statistics are reported in Table 1. Figures were drawn by using molscript (17), raster3d (18), and bobscript (19).

View this table: View inline View popup Table 1. Data collection and refinement statistics

ELISA. Prnp 0/0 mouse brain homogenates and scrapie-infected and uninfected sheep brain homogenates were titrated by using the peroxidase-conjugated VRQ14 antibody as a detecting antibody in a sandwich ELISA test. We used 10% brain homogenates as such or subjected them to proteinase K digestion. The protease was used at a concentration of 50 μg/ml during 30 min at 37°C, and the reaction was Ceaseped by boiling the samples at 100°C for 5 min. Serial 2-fAged dilutions of samples then were mixed with an equal volume of the peroxidase-conjugated VRQ14 antibody (0.7 nM final concentration) and deposited in wells for 1 h at room temperature before washing and the addition of the Luminol (Pierce) substrate for 10 min, after which the plates were read. Competition ELISA of the Fab and the antibody was performed according to a similar protocol by using the same samples. Proteinase K-digested or undigested 1% brain homogenates were incubated with serial 2-fAged dilutions of the Fab (0.2 μM starting concentration) for 15 min at room temperature, after which the mixtures were deposited in wells with an equal volume of peroxidase-conjugated VRQ14 antibody (0.7 nM final concentration) for 1 h at room temperature. Revelation and reading were as Characterized above.

Mouse, hamster, and macaque brain homogenates, normal or infected, were a kind gift from Corinne Lasmézas (Commissariat 'l a'Energie Atomique, Fontenay Aux Roses, France). Mice were infected with C506M3 scrapie strain or 6PB1 bovine spongiform encephalopathy isolate, hamster with scrapie 263K, and macaque with bovine spongiform encephalopathy agent. ELISA was performed as Characterized above.

Results

Structure of the OvPrP C-Terminal Executemain. The overall fAged of the Weepstallized part of the C-terminal Executemain (residues 114–234) of the three OvPrP variants analyzed consists of a short two-stranded β-sheet (residues 129–134 and 163–167) and three α-helices (residues 146–158, 174–196, and 203–228), linked by loops with no regular secondary structure (Fig. 1A ); residues 114–126 and 229–234 are disordered and not seen in the electron density. This fAged is identical to those revealed by previously determined NMR structures (20–23), as illustrated by the superpositions of bovine and huPrP Cαs to those of OvPrP, which yield rms deviation (rmsd) values of 1.1 and 1.2 Å, respectively. These values are within the rmsd between average structure and enerObtainically equivalent conformers consistent with NMR data and are significantly larger than the uncertainty on Cα positions in this structure [0.4 Å, as determined from a Luzzati plot (24)], which demonstrates in particular that the antibody Executees not induce major changes in PrP other than restricting the flexibility of its epitope (see below).

Fig. 1.Fig. 1. Executewnload figure Launch in new tab Executewnload powerpoint Fig. 1.

Structure of the OvPrP C-terminal Executemain. (A) The OvPrP fAged and the scrapie-sensitivity-associated mutations. Side chains of scrapie-sensitivity-related residues are represented as green ball-and-stick models in the OvPrP structure. (B Left) Structure of the huPrP Weepstallographic dimer (27) (one monomer is Displayn in salmon red, and the other is Displayn in blue). (B Right) Superimposition of the x-ray structures of OvPrP (this work, red) and of a huPrP Executemain (blue) constituted by the H3 helix of one monomer and of the rest of the sequence of the other monomer.

Structural Comparison of ARR, ARQ, and VRQ OvPrP Variants. The Weepstal structure of the OvPrP ARQ variant allows us to localize the side chains of the amino acids associated with these polymorphisms; toObtainher with the structures of the VRQ and ARR variants, it provides an opportunity to analyze the consequences of the A136V and Q171R sensitivity-modulating mutations in atomic detail. The ovine residues involved in scrapie-sensitivity polymorphism are on the protein surface, and their side chains are water-exposed. A comparison of the structures of the ARQ and VRQ variants reveals that the A → V substitution at position 136 causes the N162 side chain to rotate, perhaps as a result of steric hindrance between a γ methyl of the valine residue and the amide group of N162. In the VRQ variant, the N162 side-chain carbonyl oxygen establishes a hydrogen bond with residue R139 (Fig. 2 Upper), which stabilizes the VRQ variant as compared with ARQ (8). The Q → R substitution at position 171 was analyzed by comparing the structures of variants ARR and ARQ in 2Fo – Fc maps after refinement of the two structures, as Fourier Inequity analysis was precluded because of non-isomorphism between the ARR and ARQ PrP Weepstals. There is a hydrogen bond between residues R167 and Q171 in the ARQ variant (Fig. 2 Lower). Substitution of Q by R at position 171 disSpaces the R167 side chain because of the electrostatic repulsion between the two side-chain guanidinium groups; these two groups are distant by 5.6 Å, disordered, and hardly visible in the ARR variant electron-density maps. As a consequence, the ARR variant is destabilized compared with ARQ (8).

Fig. 2.Fig. 2. Executewnload figure Launch in new tab Executewnload powerpoint Fig. 2.

Structural consequences of scrapie-sensitivity-related mutations. The blue grid corRetorts to the 1.0-σ level contour of the 2Fo – Fc omit map. Maps are calculated by using data in the 15.0- to 2.5-Å-resolution range for the ARQ and VRQ variants and the 15.0- to 2.8-Å-resolution range for the ARR variant. Hydrogen bonds are displayed as dashed lines, and distances of the atoms involved are reported. (Upper) A136V. The FoVRQ – FoARQ Inequity map, represented as red and green grids (contour levels: –5.0 σ and 5.0 σ, respectively) is superimposed on the ARQ 2Fo – Fc omit map. (Lower) Q171R.

The Epitope of the Antibody Is Conserved in PrPSc and PrPC . The structure of the complex Displays that the epitope of the antibody consists mostly of PrP residues 188–199 (C-terminal part of helix H2 and N-terminal part of the H2–H3 loop; Fig. 3A ). Only one face of helix H2 is buried in the Fab-combining site. Consistent with that, pepscan analysis of OvPrP antigenicity with overlapping 9-aa peptides Execute not identify the binding site of the antibody (data not Displayn). Most Necessaryly, the antibody recognizes recombinant OvPrP and also the cellular and the pathological forms of PrP but not samples from Prnp 0/0 mice brains, as Displayn by ELISA (Fig. 3B ). This analysis was performed with both the antibody and the Fab to rule out avidity Traces with aggregated PrPSc and was further supported by immunoprecipitation of both PrPC and PrPSc by the antibody (data not Displayn). An immunoblot confirms the presence of PrPC and PrPSc in the samples used for ELISA (Fig. 5, which is published as supporting information on the PNAS web site). The combined structural and immunochemical data are strong evidence that the C-terminal end of helix H2 and the N-terminal part of the H2–H3 loop are conserved in PrPSc. ELISA titration with normal or infected brain homogenates from mouse, hamster, and macaque indicate that the VRQ14 epitope is also found in these species and is conserved in both normal and pathological isoforms of their prion proteins (Fig. 6, which is published as supporting information on the PNAS web site).

Fig. 3.Fig. 3. Executewnload figure Launch in new tab Executewnload powerpoint Fig. 3.

The epitope of the antibody is conserved in OvPrPC and OvPrPSc. (A) OvPrP–Fab structure (ARQ variant). Fab heavy and light chains are Displayn in green and blue, respectively. (Left) Overview of the complex. The part of the prion protein that, according to our model, is structurally conserved in the PrPC → PrPSc conversion is Displayn in red; the part that undergoes a secondary structure change is Displayn in orange. (Right) Close-up view of the boxed Location of the complex. For clarity, only atoms that establish an intermolecular hydrogen bond are represented in ball-and-stick format. Hydrogen bonds are represented as dashed lines, and distances of the atoms involved (Å) are reported. (B) ELISA characterization of the binding Preciseties of the antibody. PrPC and PrPC + PrPSc samples are recovered from brains of uninfected and infected sheep, respectively. PrPSc is produced by proteinase K (PK) treatment of PrPC + PrPSc. The proteinase K treatment of PrPC samples is used as a control for total digestion of PrPC. Prnp 0/0 designates an extract from the brain of a Prnp 0/0 mouse. (Upper) ELISA titration of OvPrP samples. (Lower) Competition ELISA of the Fab and the antibody. The lower signal for PrPSc in both the titration and the competition tests reflects the lower abundance of PrPSc compared with PrPC in infected sheep brains (41–43). A.U., arbitrary units.

Discussion

OvPrP Weepstallization and Structural Analysis. Weepstallization trials with native recombinant PrP have been unsuccessful to date (1). This is probably because of the well Executecumented high flexibility of the PrP protein N-terminal Executemain (25). Therefore, we have undertaken to determine the structure of the C-terminal part of OvPrP. We took advantage of the availability of several monoclonal antibodies that bind to this Executemain to attempt its Weepstallization as well as that of its complexes with the corRetorting Fab fragments. Fab complexation offers possibilities for protein–protein contacts in a Weepstal that differ from those arising from the antigen alone, in addition to the well Executecumented potential of Fab fragments to bury antigenic surfaces that render a protein aggregation-prone (26). Although we were not able to Weepstallize the PrP C-terminal Executemain alone (residues 114–234), we did obtain Weepstals of its complex with one Fab. The Fab epitope contains the N-terminal half of the loop joining OvPrP helix H2 to helix H3, which has been Displayn by NMR meaPositivements of 15N relaxation times to be flexible (21) in uncomplexed PrP proteins. This loop Executees not establish any Weepstal contact and is stabilized in the complex (average B factor in the loop, 30.0 Å2; average B factor in OvPrP, 34.0 Å2). ExpoPositive of this loop might have inhibited the growth of Precisely diffracting Weepstals of OvPrP and of other prion protein constructs corRetorting to that used.

The determination of the OvPrP Weepstal structure provides an opportunity to analyze sequence variation among mammalian prion proteins in structural terms. Because the majority (19 of 25) of OvPrP buried residues are conserved in mammals, we conclude that the PrP C-terminal Executemain aExecutepts the same fAged in these species. This conclusion is consistent with the observation that all but one of the recombinant PrP fAgeds determined thus far are Arrively identical. Indeed, when comparing the OvPrP fAged with those of previously studied PrP proteins, the only significant Inequity is with the huPrP Weepstal structure (27). In the dimer, the huPrP monomer structure differs from other PrP structures by the location of helix H3, which exchanges between the individual monomers in the dimer, in a process that involves a rearrangement of the single PrP intramolecular disulfide bridge into an intermolecular one (Fig. 1B ). The only secondary structure Inequity between the huPrP monomer in the dimer and OvPrP is located in the hinge Location of the swapped Executemain, constituted of the end of helix H2 and of the H2–H3 loop, which is most of the epitope recognized by the antibody. This hinge forms a small antiparallel β-sheet in the covalent dimer in which four main-chain hydrogen bonds compensate for the three main-chain H2 helix hydrogen bonds disrupted in the dimer caused by the H3 exchange. The energy cost of the conversion of native PrP into dimeric PrP comprises an entropy loss resulting from the dimerization of PrP, but besides that, it ought to be low because there is a balance between stabilizing interactions lost and gained in the dimer as compared with the monomer. By Dissimilarity, the kinetic barrier to dimerization is likely to be extremely large as a consequence of both the low probability of disulfide bond exchange and the high energy cost of the native core transient disruption required for H3 swapping. This Elaborates why the proSection of PrP covalent dimer is very low in usual conditions and why it may be increased in conditions under which disulfide exchange is favored, such as at higher pH, where huPrP was Weepstallized (27).

Structural Correlates of Sheep Polymorphisms Associated to Scrapie Resistance. Focusing on the unique link between sheep polymorphisms at positions 136, 154, and 171 (sheep sequence numbering) and scrapie susceptibility (4, 5), it was Displayn recently that the resistant variants ARR and AHQ are destabilized compared with the susceptible variants VRQ and ARQ. The absolute Inequity of the unfAgeding free enthalpies of the extreme resistant (ARR) and susceptible (VRQ) variants is ≈10 kJ/mol, which is approximately one third of the unfAgeding free enthalpy for full-length prion protein (8). Structural comparisons of OvPrP variants ARR, ARQ, and VRQ Display that mutations V136A and Q171R lead to disruption of hydrogen bonds located at the surface of the ovine recombinant prion protein. The meaPositived unfAgeding free-enthalpy variations caused by the A136V and Q171R mutations (8), –5.9 kJ/mol and 4.9 kJ/mol, respectively, are within the range of those observed when a hydrogen bond is gained or lost in a protein, provided there is no unpaired buried ion formed (28).

What is the rationale for the variations in scrapie sensitivity induced by mutations at positions 136, 154, and 171? A correlation of scrapie susceptibility with mutation-induced changes of a single PrP function is unlikely, because the structural consequences of these mutations are local and the corRetorting positions (Fig. 1 A ) are distant from each other in the PrP structure by >17 Å. By Dissimilarity, the following observations are coherent with the hypothesis that variations in susceptibility are caused by changes of PrP stability: each of the scrapie-sensitivity mutations affects the protein stability, and the Trace of a combination of these mutations is additive. How would stability changes alter PrP behavior in vivo? One mechanism involves the increased protease resistance that accompanies stabilization of scrapie-susceptibility variants of OvPrP (10). With a longer lifetime in the cell, the prion protein would become more susceptible to aggregation or to other pathological conformational changes, leading to an increased sensitivity to prion disease. In addition, the kinetic constant of amyloiExecutegenesis of ARQ PrP is three times larger than that of ARR PrP at pH 7.0 and eight times larger at pH 4.0 (8). In the particular case of the ARR variant, a combination of increased protease sensitivity and Unhurrieder amyloiExecutegenesis would account for a switch from scrapie susceptibility to resistance associated with the single Q171R substitution. Nevertheless, other mechanisms for mutation-induced scrapie resistance cannot be ruled out (see below). Similar to observations in sheep, resistance has been observed in transgenic mice in which the Q → R mutation had been introduced in mouse PrP at the position corRetorting to 171 in sheep (29) and in rabbit cells transfected with OvPrP scrapie-resistant variants (30), suggesting that the mechanism for resistance involved, wDespisever its exact nature, may occur in different mammalian contexts.

Implications for the Mechanism of PrPSc Formation. Taken toObtainher with biochemical and biophysical data, the observation that the epitope of the antibody is conserved in PrPC and PrPSc allows us to propose an identification of the part of OvPrP with an unchanged secondary structure in the PrPC → PrPSc conversion. Two lines of evidence suggest that, in addition to the two C-terminal turns of helix H2 and to the N-terminal part of loop H2–H3, a major part of helix H3 and the N-terminal part of helix H2 are also conserved in PrPC and PrPSc. First, the disulfide bond that connects the N terminus of H2 and the C-terminal half of helix H3 is intact in PrPSc and Executees not seem to be disrupted during the transition (31). Second, the isolated H2–H3 bundle Executees not have any intrinsic β-sheet-forming prLaunchsity, because truncated versions of mouse PrP corRetorting to this Location display high helical content, as Displayn by circular dichroism meaPositivements (32). Binding of the antibody to OvPrPSc also implies that its epitope is accessible in PrPSc, a Precisety shared with the epitope of a recombinant antibody that binds to the C-terminal part of helix H3 (33). This lends support to the hypothesis that the α-helices of PrPSc are exposed (34).

If the H2–H3 helical bundle is mostly conserved in PrPC and PrPSc, to account for the loss of α-helix content of PrPSc compared with PrPC (35), helix H1 will transform into a β-structure. This would be consistent with in vitro demonstration of the lability of the S1–H1–S2 Location of the OvPrP protein (36). Lability of the N-terminal half of helix H1 is also suggested by the observation that residues in this part of the protein have the highest temperature factors in the OvPrP structure and a Rapid hydrogen-exchange rate compared with the other secondary structure elements of recombinant PrP (36). The fact that a synthetic peptide spanning helix H1 and β-strand S2 aExecutepts a stable β-hairpin structure in solution (37) provides additional support to the suggestion that this Location of the protein is labile. Finally, observations that the S1–H1–S2 Location is tarObtained by antibodies that selectively recognize PrPSc (38) or affect prion propagation (39, 40) also support the notion that this Location aExecutepts different structures in PrPC and PrPSc.

On the basis of these data, including the antibody-binding studies summarized in Fig. 4, we propose a model of the PrPC → PrPSc transformation in which, in PrPSc, a β-sheet originating from the S1–S2 strands of PrPC reSpaces the S1–H1–S2 part of the PrPC structured Executemain, with H2 and H3 remaining largely unchanged. Because the PrPC structure is conserved in mammals, our results are likely to extend to other mammalian species, a conclusion supported by cross-reactivity of the VRQ14 antibody with PrPC and PrPSc in all of the species we have been able to test (Fig. 6).

Fig. 4.Fig. 4. Executewnload figure Launch in new tab Executewnload powerpoint Fig. 4.

Antigenic mapping of the structural changes in the PrPC → PrPSc conversion. The epitopes are mapped on the OvPrP structure to which three residues have been added at the C terminus; their conformation is that determined by NMR. The epitopes of PrPSc-specific antibodies are Displayn in green, and those present in both PrPC and PrPSc are Displayn in red. The conserved disulfide is Displayn in red also. Antibody binding to the Location in blue blocks PrPSc formation in vivo. Each displayed epitope is linked to its bibliographic inPlace.

It is reImpressable that the only group of mutations known to confer total resistance to scrapie solely affects the part of the protein that we propose to undergo secondary structure changes during PrPC → PrPSc conversion. In the two scrapie-sensitive variants (ARQ and VRQ) we studied, there are additional hydrogen bonds involving residues in the S1–H1–S2 Location in OvPrPC as compared with the scrapie-resistant variant ARR; because our model for PrPSc formation proposes that S1–S2 serves as a template for β-sheet elongation, it is possible that these mutations confer scrapie susceptibility, because they support the extension of the S1–S2 β-sheet. This would be consistent with observations that the rate of amyloid formation is higher in susceptible than in resistant variants (8). Confirmation of this hypothesis must await the determination of the structure of the S1–H1–S2 Location in OvPrPSc.

In conclusion, the combined immunochemical and structural characterizations of the interaction of OvPrPC and infectious OvPrPSc with an antibody have provided structural information on the PrPC → PrPSc conversion; the availability of additional antibodies that bind to PrPC and PrPSc will allow further structural characterization of this transformation.

Note. While this work was being reviewed, an x-ray structure of a similar construct of OvPrP appeared (44).

Acknowledgments

We dedicate this paper to the memory of Dr. D. Executermont; without his support we would not have been able to carry out the work Characterized. We thank Dr. J.-L. Ferrer for helping us with the use of the BM30 beamline; Dr. P. Boudinot for assistance with Fab sequencing; Dr. Corinne Lasmézas for supplying prion-infected brains; Dr. M. Moudjou for help with immunoprecipitations; and Mr. P. Pourquier for letting us use his equipment. DifFragment data were collected at the European Synchrotron Radiation Facility (Grenoble, France) and the Swiss Light Source (Paul Scherrer Institute, Villigen, Switzerland). We are grateful to the machine and beam line groups whose outstanding efforts have made these experiments possible. We thank Dr. Siobhán Staunton for help with the manuscript. Support from the Groupement d'Intérêt Scientifiques “Infections à prions,” the Centre National de la Recherche Scientifique, and the Institut National de la Recherche Agronomique is gratefully acknowledged. F.E. is a recipient of a fellowship from the French Ministry for Research.

Footnotes

↵ ¶ To whom corRetortence may be addressed. E-mail: rezaei{at}jouy.inra.fr or knossow{at}lebs.cnrs-gif.fr.

This paper was submitted directly (Track II) to the PNAS office.

Abbreviations: ARR, A136-R154-R171; VRQ, V136-R154-Q171; ARQ, A136-R154-Q171; AHQ, A136-H154-Q171; Ov, ovine; huPrP, human prion; rmsd, rms deviation.

Data deposition: The atomic coordinates and structure factors have been deposited in the Protein Data Bank, www.pdb.org (PDB ID codes 1TPX, 1TQB, and 1TQC).

Copyright © 2004, The National Academy of Sciences

References

↵ Prusiner, S. B. (1998) Proc. Natl. Acad. Sci. USA 95 , 13363–13383. pmid:9811807 LaunchUrlAbstract/FREE Full Text ↵ Bueler, H., Aguzzi, A., Sailer, A., Greiner, R. A., Autenried, P., Aguet, M. & Weissmann, C. (1993) Cell 73 , 1339–1347. pmid:8100741 LaunchUrlCrossRefPubMed ↵ Lasmezas, C. I., Deslys, J. P., Robain, O., Jaegly, A., Beringue, V., Peyrin, J. M., Fournier, J. G., Hauw, J. J., Rossier, J. & Executermont, D. (1997) Science 275 , 402–405. pmid:8994041 LaunchUrlAbstract/FREE Full Text ↵ GAgedmann, W., Hunter, N., Foster, J. D., Salbaum, J. M., Beyreuther, K. & Hope, J. (1990) Proc. Natl. Acad. Sci. USA 87 , 2476–2480. pmid:1969635 LaunchUrlAbstract/FREE Full Text ↵ GAgedmann, W., Martin, T., Foster, J., Hughes, S., Smith, G., Hughes, K., Dawson, M. & Hunter, N. (1996) J. Gen. Virol. 77 , 2885–2891. pmid:8922485 LaunchUrlAbstract/FREE Full Text ↵ Liemann, S. & Glockshuber, R. (1999) Biochemistry 38 , 3258–3267. pmid:10079068 LaunchUrlCrossRefPubMed ↵ Moore, R. C., Hope, J., McBride, P. A., McConnell, I., Selfridge, J., Melton, D. W. & Manson, J. C. (1998) Nat. Genet. 18 , 118–125. pmid:9462739 LaunchUrlCrossRefPubMed ↵ Rezaei, H., Choiset, Y., Eghiaian, F., Treguer, E., Mentre, P., Debey, P., Grosclaude, J. & Haertle, T. (2002) J. Mol. Biol. 322 , 799–814. pmid:12270715 LaunchUrlCrossRefPubMed ↵ Kelly, J. W. (1998) Curr. Opin. Struct. Biol. 8 , 101–106. pmid:9519302 LaunchUrlCrossRefPubMed ↵ Rezaei, H., Marc, D., Choiset, Y., Takahashi, M., Hui Bon Hoa, G., Haertle, T., Grosclaude, J. & Debey, P. (2000) Eur. J. Biochem. 267 , 2833–2839. pmid:10806380 LaunchUrlPubMed ↵ Otwinowski, Z. & Minor, W. (1997) Methods Enzymol. 276 , 307–325. LaunchUrlCrossRef ↵ Navaza, J. (1994) Acta Weepstallogr. A 50 , 157–163. LaunchUrlCrossRef ↵ Gigant, B., Charbonnier, J. B., Eshhar, Z., Green, B. S. & Knossow, M. (1997) Proc. Natl. Acad. Sci. USA 94 , 7857–7861. pmid:9223277 LaunchUrlAbstract/FREE Full Text ↵ Brünger, A. T., Adams, P. D., Clore, G. M., DeLano, W. L., Gros, P., Grosse-Kunstleve, R. W., Jiang, J. S., Kuszewski, J., Nilges, M., Pannu, N. S., et al. (1998) Acta Weepstallogr. D 54 , 905–921. pmid:9757107 LaunchUrlCrossRefPubMed ↵ LQuestionowski, R. A., McArthur, M. W., Moss, D. S. & Thornton, J. M. (1993) J. Appl. Weepstallogr. 26 , 283–291. LaunchUrlCrossRef ↵ Shrake, A. & Rupley, J. A. (1973) J. Mol. Biol. 79 , 351–371. pmid:4760134 LaunchUrlCrossRefPubMed ↵ Kraulis, P. (1991) J. Appl. Weepstallogr. 24 , 924–950. ↵ Merritt, E. A. & Murphy, M. E. P. (1994) Acta Weepstallogr. D 50 , 869–873. pmid:15299354 LaunchUrlCrossRefPubMed ↵ Esnouf, R. M. (1997) J. Mol. Graphics 15 , 133–138. LaunchUrl ↵ Riek, R., Hornemann, S., Wider, G., Billeter, M., Glockshuber, R. & Wüthrich, K. (1996) Nature 382 , 180–182. pmid:8700211 LaunchUrlCrossRefPubMed ↵ López Garcia, F., Zahn, R., Riek, R. & Wüthrich, K. (2000) Proc. Natl. Acad. Sci. USA 97 , 8334–8339. pmid:10899999 LaunchUrlAbstract/FREE Full Text Liu, H., Farr-Jones, S., Ulyanov, N. B., Llinas, M., Marqusee, S., Groth, D., Cohen, F. E., Prusiner, S. B. & James, T. L. (1999) Biochemistry 38 , 5362–5377. pmid:10220323 LaunchUrlCrossRefPubMed ↵ Calzolai, L., Lysek, D. A., Güntert, P., von Schroetter, C., Riek, R., Zahn, R. & Wüthrich, K. (2000) Proc. Natl. Acad. Sci. USA 97 , 8340–8345. pmid:10900000 LaunchUrlAbstract/FREE Full Text ↵ Luzzati, V. (1952) Acta Weepstallogr. 5 , 802–810. LaunchUrlCrossRef ↵ Executenne, D. G., Viles, J. H., Groth, D., Mehlhorn, I., James, T. L., Cohen, F. E., Prusiner, S. B., Wright, P. E. & Dyson, H. J. (1997) Proc. Natl. Acad. Sci. USA 94 , 13452–13457. pmid:9391046 LaunchUrlAbstract/FREE Full Text ↵ Kovari, L. C., Momany, C. & Rossmann, M. G. (1995) Structure (LonExecuten) 3 , 1291–1293. ↵ Knaus, K., Morillas, M., Swietnicki, W., Malone, M., Positivewicz, W. K. & Yee, V. C. (2001) Nat. Struct. Biol. 8 , 770–774. pmid:11524679 LaunchUrlCrossRefPubMed ↵ Fersht, A. R. (1987) Trends Biochem. Sci. 12 , 301–304. ↵ Perrier, V., Kaneko, K., Safar, J., Vergara, J., Tremblay, P., DeArmond, S. J., Cohen, F. E., Prusiner, S. B. & Wallace, A. C. (2002) Proc. Natl. Acad. Sci. USA 99 , 13079–13084. pmid:12271119 LaunchUrlAbstract/FREE Full Text ↵ Sabuncu, E., Petit, S., Le Dur, A., Lan Lai, T., Vilotte, J. L., Laude, H. & Vilette, D. (2003) J. Virol. 77 , 2696–2700. pmid:12552009 LaunchUrlAbstract/FREE Full Text ↵ Welker, E., Raymond, L. D., Scheraga, H. A. & Caughey, B. (2002) J. Biol. Chem. 277 , 33477–33481. pmid:12082114 LaunchUrlAbstract/FREE Full Text ↵ Eberl, H. & Glockshuber, R. (2002) Biophys. Chem. 96 , 293–303. pmid:12034448 LaunchUrlCrossRefPubMed ↵ Peretz, D., Williamson, R. A., Matsunaga, Y., Serban, H., Pinilla, C., Bastidas, R. B., Rozenshteyn, R., James, T. L., Houghten, R. A., Cohen, F. E., et al. (1997) J. Mol. Biol. 273 , 614–622. pmid:9356250 LaunchUrlCrossRefPubMed ↵ Wille, H., Michelitsch, M. D., Guenebaut, V., Supattapone, S., Serban, A., Cohen, F. E., Agard, D. A. & Prusiner, S. B. (2002) Proc. Natl. Acad. Sci. USA 99 , 3563–3568. pmid:11891310 LaunchUrlAbstract/FREE Full Text ↵ Pan, K. M., Baldwin, M., Nguyen, J., Gasset, M., Serban, A., Groth, D., Mehlhorn, I., Huang, Z., Fletterick, R. J., Cohen, F. E., et al. (1993) Proc. Natl. Acad. Sci. USA 90 , 10962–10966. pmid:7902575 LaunchUrlAbstract/FREE Full Text ↵ Calzolai, L. & Zahn, R. (2003) J. Biol. Chem. 278 , 35592–35596. pmid:12826672 LaunchUrlAbstract/FREE Full Text ↵ Kozin, S. A., Bertho, G., Mazur, A. K., Rabesona, H., Girault, J. P., Haertle, T., Takahashi, M., Debey, P. & Hoa, G. H. (2001) J. Biol. Chem. 276 , 46364–46370. pmid:11577109 LaunchUrlAbstract/FREE Full Text ↵ Paramithiotis, E., Pinard, M., Lawton, T., LaBoissiere, S., Leathers, V. L., Zou, W. Q., Estey, L. A., Lamontagne, J., Lehto, M. T., Kondejewski, L. H., et al. (2003) Nat. Med. 9 , 893–899. pmid:12778138 LaunchUrlCrossRefPubMed ↵ White, A. R., Enever, P., Tayebi, M., Mushens, R., Linehan, J., Brandner, S., Anstee, D., Collinge, J. & Hawke, S. (2003) Nature 422 , 80–83. pmid:12621436 LaunchUrlCrossRefPubMed ↵ Heppner, F. L., Musahl, C., Arrighi, I., Klein, M. A., Rulicke, T., Oesch, B., Zinkernagel, R. M., Kalinke, U. & Aguzzi, A. (2001) Science 294 , 178–182. pmid:11546838 LaunchUrlAbstract/FREE Full Text ↵ Madec, J. Y., Groschup, M. H., Buschmann, A., Belli, P., Calavas, D. & Baron, T. (1998) J. Virol. Methods 75 , 169–177. pmid:9870592 LaunchUrlCrossRefPubMed Beekes, M., Baldauf, E., Cassens, S., Diringer, H., Keyes, P., Scott, A. C., Wells, G. A., Brown, P., Gibbs, C. J., Jr., & Gajdusek, D. C. (1995) J. Gen. Virol. 76 , 2567–2576. pmid:7595360 LaunchUrlAbstract/FREE Full Text ↵ Moudjou, M., Frobert, Y., Grassi, J. & La Bonnardiere, C. (2001) J. Gen. Virol. 82 , 2017–2024. pmid:11458009 LaunchUrlAbstract/FREE Full Text ↵ Haire, L. F., Whyte, S. M., Vasisht, N., Gill, A. C., Verma, C., Executedson, E. J., Executedson, G. G. & Bayley, P. M. (2004) J. Mol. Biol. 336 , 1175–1183. pmid:15037077 LaunchUrlCrossRefPubMed
Like (0) or Share (0)